Información

¿Pueden los genes reguladores expresarse mejor cuando tiene más lugares para unirse?

¿Pueden los genes reguladores expresarse mejor cuando tiene más lugares para unirse?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estoy investigando un poco el cáncer de pulmón de células pequeñas y, por lo que he encontrado, muchos tumores muestran niveles altos de ASCL1, que es un regulador de la diferenciación de las células neuroendocrinas. Sin embargo, ningún artículo propone un mecanismo para los niveles más altos de ASCL1. En cambio, muchos de ellos se refieren a genes diana de ASCL1 con potenciadores "amplificados" y proponen que ASCL1 puede unirse con más frecuencia a estas regiones potenciadoras.

En general, si hay más lugares para que el regulador se una a un potenciador, ¿es posible que esto sea suficiente para que el regulador se exprese mejor?


CircRNA y cáncer: biomarcadores y reguladores maestros

Los ARN circulares (circRNA) son una nueva clase de ARN reguladores que, a pesar de ser relativamente abundantes, solo han comenzado a explorarse recientemente. Hay muchos miles de genes que parecen capaces de producir circRNAs, sin embargo, la función de todos menos unos pocos queda por determinar. Lo que está surgiendo acerca de estas moléculas altamente conservadas es que desempeñan un papel importante en la biología y en la biología del cáncer en particular. La función más explorada de los circRNAs es como reguladores maestros de la expresión génica que actúan para secuestrar o "esponjar" otros reguladores de la expresión génica, en particular miRNA. También se ha demostrado que funcionan vía modulación directa de la transcripción e interfiriendo con los mecanismos de empalme. Aunque generalmente se expresan en baja abundancia en comparación con sus contrapartes lineales, a menudo se expresan de una manera específica para el tejido y la etapa de desarrollo. Junto con su notable resistencia a la actividad de la ARNasa debido a una estructura cíclica cerrada covalente, los circRNA son muy prometedores como nuevos biomarcadores de cáncer y otras enfermedades. En esta revisión consideramos el estado actual del conocimiento sobre estas moléculas, su síntesis, función y asociación con el cáncer. También revisaremos algunos de los desafíos que quedan por resolver si esta clase emergente de ARN realmente va a ser útil en la clínica.


Los 'genes saltarines' forman repetidamente nuevos genes a lo largo de la evolución

De la misma manera que las piezas de Lego se pueden organizar de nuevas formas para construir una variedad de estructuras, los elementos genéticos se pueden mezclar y combinar para crear nuevos genes, según una nueva investigación.

Un mecanismo propuesto desde hace mucho tiempo para crear genes, llamado mezcla de exones, funciona mezclando bloques funcionales de secuencias de ADN en nuevos genes que expresan proteínas.

Un estudio, "Recurrent Evolution of Vertebrate Transcription Factors by Transposase Capture", publicado el 19 de febrero en Ciencias, investiga cómo los elementos genéticos llamados transposones, o "genes saltarines", se agregan a la mezcla durante la evolución para ensamblar nuevos genes mediante la mezcla de exones.

Transposons, descubierto por primera vez en la década de 1940 por la ex alumna de Cornell y ganadora del Premio Nobel Barbara McClintock '23, M.A. '25, Ph.D. '27, son abundantes componentes de los genomas (constituyen la mitad del ADN humano) y tienen la capacidad de saltar y replicarse egoístamente en el genoma. Algunos transposones contienen sus propios genes que codifican enzimas llamadas proteínas transposasas, que cortan y pegan material genético de una ubicación cromosómica a otra.

El estudio, que se centró en los tetrápodos (vertebrados de cuatro extremidades), es importante porque muestra que los transposones representan una fuerza importante en la creación de nuevos genes durante la evolución. El trabajo también explica cómo nacieron los genes críticos para el desarrollo humano.

"Creemos que es muy probable que este mecanismo se extienda más allá de los vertebrados y podría ser más un mecanismo fundamental que ocurre también en los no vertebrados", dijo la primera autora Rachel Cosby, Ph.D. '19, investigador postdoctoral en los Institutos Nacionales de Salud. Cosby es un ex estudiante de posgrado en el laboratorio del autor principal Cedric Feschotte, profesor del Departamento de Biología Molecular y Genética de la Facultad de Agricultura y Ciencias de la Vida.

"Estás colocando los ladrillos de una manera diferente y construyes algo completamente nuevo", dijo Feschotte. "Estamos analizando la cuestión de cómo nacen los genes. La originalidad es que estamos analizando el papel de los transposones en la creación de proteínas con una función novedosa en la evolución".

En el estudio, los investigadores primero extrajeron las bases de datos existentes de genomas de tetrápodos, porque los genomas de más de 500 especies se han secuenciado completamente. Cosby y sus colegas buscaron combinaciones de secuencias de ADN que se sabe son características de los transposones fusionados con las secuencias del huésped para encontrar buenos candidatos para el estudio. Luego eligieron genes que evolucionaron hace relativamente poco tiempo, hace decenas de millones de años, para poder rastrear la historia del desarrollo del gen a través del árbol de la vida de los vertebrados.

Aunque los genes fusionados con estas transposasas son relativamente raros, los investigadores los encontraron en todo el árbol de la vida de los vertebrados. Los investigadores identificaron más de 100 genes distintos fusionados con transposasas nacidas en los últimos 350 millones de años a lo largo de diferentes linajes de especies, incluidos genes de aves, reptiles, ranas, murciélagos y koalas, y un total de 44 genes nacidos de esta manera en el genoma humano.

Cosby y sus colegas seleccionaron cuatro genes recientemente evolucionados y realizaron una amplia gama de experimentos en cultivo celular para comprender sus funciones. Descubrieron que las proteínas derivadas de estos genes pueden unirse a secuencias de ADN específicas y desactivar la expresión génica. Estos genes se conocen como factores de transcripción y actúan como genes reguladores maestros para el desarrollo y la fisiología básica. Uno de esos genes, PAX6, está bien estudiado, juega un papel clave como regulador maestro en la formación de ojos en todos los animales y está altamente conservado a lo largo de la evolución.

"Si pones un gen PAX6 de un ratón en una Drosophila [mosca de la fruta], funciona", dijo Feschotte. Aunque otros han propuesto antes que PAX6 se deriva de una fusión de transposasa, los investigadores de este estudio validaron aún más la hipótesis.

Cosby y sus colegas aislaron uno de estos genes recientemente evolucionados en murciélagos, llamado KRABINER, y luego utilizaron la tecnología de edición de genes CRISPR para eliminarlo del genoma del murciélago y ver qué genes estaban afectados, antes de volver a agregarlo. El experimento reveló que cuando KRABINER se eliminó, cientos de genes se desregularon y, cuando lo restauraron, regresó el funcionamiento normal. La proteína expresada por el gen KRABINER se unió a otros transposones relacionados en el genoma del murciélago, dijo Cosby.

"El experimento reveló que controla una gran red de otros genes conectados a través de la dispersión pasada de transposones relacionados en todo el genoma del murciélago, creando no solo un gen, sino lo que se conoce como una red reguladora de genes", dijo Feschotte.


Entrega de premios por Richard Lifton

La mera existencia de la vida parece milagrosa. El desarrollo de una sola célula de una planta, un insecto o un ser humano, cada uno de los cuales contiene células y órganos especializados con funciones radicalmente diferentes, representa uno de los grandes misterios. Ahora entendemos que todas las formas de vida en la tierra usan información codificada en el ADN como manual de instrucciones para construir un organismo adulto. Las instrucciones se ejecutan copiando segmentos de ADN, llamados genes, en copias de ARN, que dirigen la producción de las proteínas que crean una célula muscular, una célula hepática o una neurona. Esto requiere que diferentes conjuntos de genes estén activados, desactivados o sintonizados a los niveles correctos en diferentes tipos de células. Además, la expresión génica también debe modularse para responder a cambios periódicos en el entorno externo.

Nuestros primeros conocimientos sobre cómo los genes se activan y desactivan selectivamente provienen de estudios de la bacteria. E. coli por Jacob y Monod a principios de la década de 1960. Establecieron el paradigma de que los factores de transcripción, proteínas que se unen a secuencias específicas de ADN, promueven o inhiben la copia de ADN en ARN.

Más información

No obstante, existen diferencias notables entre bacterias y eucariotas, es decir, plantas, animales y hongos. Por ejemplo, el genoma humano es casi 1000 veces más grande que E. coli. El ADN extendido de una célula humana tiene 6 pies de largo, pero está comprimido en un núcleo que tiene un radio de solo 3 micrones, lo que plantea un grave problema de organización / gestión. El ADN cromosómico de los eucariotas, pero no de las bacterias, está asociado con una familia de pequeñas proteínas llamadas histonas. La investigación de Roger Kornberg, Tim Richmond y otros mostró que este complejo de ADN-proteína comprende una cadena de perlas, llamadas nucleosomas, y cada cuenta tiene un núcleo de proteínas histonas con ADN envuelto alrededor del exterior. Estas perlas se empaquetan en conjuntos de orden superior en los cromosomas, con la longitud de las fibras de ADN comprimidas hasta 10.000 veces durante la división celular.

La uniformidad de las perlas de histonas y su falta de preferencia por secuencias de ADN específicas llevó a la amplia presunción de que estos nucleosomas eran simplemente el material de empaquetamiento inerte para el ADN en el núcleo. No obstante, en la década de 1960 Vincent Allfrey había hecho la provocadora observación de que las proteínas histonas podían modificarse químicamente. Demostró que las histonas acetiladas se enriquecían en partes del genoma altamente expresadas y se reducían en segmentos que no expresan genes. Sin embargo, las herramientas disponibles en ese momento no pudieron establecer si la modificación de las histonas era una causa o una consecuencia de la expresión génica, y estas observaciones languidecieron.

Ingrese Michael Grunstein, quien en la década de 1980 se propuso probar la idea de que las histonas desempeñaban un papel activo en la regulación de la expresión génica. Estudió la levadura de panadería.S. cerevisiae—Porque este hongo unicelular podría manipularse genéticamente. Grunstein diseñó levadura en la que la producción de histonas podía activarse y desactivarse a voluntad. En 1987, Grunstein y sus colegas informaron que la desactivación de la producción de histonas conducía a un agotamiento de los nucleosomas sorprendentemente, y descubrieron que esto provocaba la activación de la expresión de genes que normalmente estaban desactivados, lo que indica por primera vez que los nucleosomas regulan la expresión de genes in vivo.

Luego hizo una pregunta aún más ambiciosa: ¿las mutaciones específicas del ADN que alteran las proteínas histonas alteran la expresión génica? En una elegante serie de experimentos, mostró primero que la deleción de un trozo corto de un extremo de una de las proteínas histonas, llamadas H4, eliminaba selectivamente la inducción de la expresión de genes que están altamente regulados por la disponibilidad de diferentes nutrientes en el medio ambiente. Es importante destacar que este segmento incluyó los cuatro sitios de la proteína que fueron acetilados. Luego mutó estos cuatro sitios para que ya no pudieran acetilarse y demostró que estas mutaciones eran suficientes para evitar la activación de estos genes.

Por el contrario, Grunstein descubrió además mutaciones en las colas de histonas que activaron la expresión génica al evitar la compactación normal de los cromosomas en segmentos altamente condensados ​​llamados heterocromatina en los que la expresión génica está apagada. Aclaró un hermoso mecanismo bioquímico que muestra cómo esta heterocromatina se propaga en continuidad a lo largo del cromosoma, explicando un fenómeno bien descrito pero misterioso.

El trabajo pionero de Grunstein estableció por primera vez la relación causal entre las alteraciones de sitios específicos en las proteínas histonas en la activación normal y la represión de la expresión génica.

Paralelamente, David Allis estaba utilizando la bioquímica para aislar las enzimas que median la modificación de las histonas. Los niveles de estas enzimas eran extremadamente bajos en las células, lo que llevó a Allis a recurrir a Tetrahymena, un protozoo inusual en el que la expresión génica se produce en núcleos en los que el ADN cromosómico se fragmenta en pequeños trozos del tamaño de un gen que luego se amplifica a un alto número de copias. Estos núcleos tienen altos niveles de expresión génica con altos niveles de acetilación de histonas. Mediante un ingenioso enfoque experimental, el equipo de Allis purificó en 1996 la primera histona acetil transferasa. La secuencia de esta proteína proporcionó una sorpresa espectacular, revelando que estaba estrechamente relacionada con una desconcertante proteína de levadura, Gcn5p, que había sido identificada como una proteína que no se unía al ADN pero que, sin embargo, era necesaria como compañera de diferentes factores de transcripción para activarse. expresión de genes altamente regulados. En poco tiempo, el equipo de Allis demostró que este coactivador de levadura, al igual que su Tetrahymena contraparte, acetila selectivamente los sitios en las colas de histonas que se acetilan in vivo.

Estos estudios implicaron colectivamente la modificación covalente de las proteínas histonas en la regulación normal de la expresión génica, y prendieron fuego al campo, atrayendo a un gran número de científicos talentosos. El torrente de trabajo resultante ha cambiado nuestra comprensión de la expresión génica regulada y ha revelado un lenguaje previamente no reconocido en el que diferentes modificaciones químicas de sitios específicos en proteínas histonas tienen distintas consecuencias. Por ejemplo, la acetilación en un sitio particular promueve la activación de la expresión génica, mientras que la metilación en ese mismo sitio inhibe la expresión génica. Por el contrario, la metilación en un sitio diferente, trabajando a través de una proteína adaptadora diferente, promueve la activación de la expresión, y la fosforilación de otro sitio más promueve la compactación extrema de los cromosomas antes de la división celular. Allis ha jugado un papel importante en el descubrimiento de muchas de estas modificaciones de histonas y el mecanismo de sus efectos. Es importante destacar que estas modificaciones químicas pueden persistir, proporcionando una memoria celular que sostiene la diferenciación de los tipos de células y pueden cebar genes particulares que se han activado transitoriamente, por ejemplo, en respuesta a una lesión, para que estén listos para una reactivación inmediata en caso de lesión en el mismo sitio se repite.

Grunstein y Allis desempeñaron un papel clave en la apertura de este campo robusto y han desempeñado papeles directos en muchos de estos descubrimientos transformadores.

La importancia de estas modificaciones de histonas se ha vuelto cada vez más clara con el tiempo. Algunas anomalías clásicas del desarrollo en la mosca de la fruta Drosophila, en las que una parte del cuerpo se transforma en otra, demostraron ser causadas por mutaciones que anulan las enzimas modificadoras de histonas. Y en los últimos años estos hallazgos se han extendido a los humanos, donde las mutaciones en modificadores de histonas y lectores de estas modificaciones son la causa más frecuente de malformaciones congénitas como la cardiopatía congénita y también son una causa frecuente de anomalías del neurodesarrollo como el autismo. Además, las mutaciones somáticas en docenas de modificadores de histonas diferentes o en los sitios de las histonas que modifican son impulsoras de una amplia gama de cánceres. En un ejemplo sorprendente, los gliomas pediátricos, un cáncer cerebral devastador, comúnmente se atribuyen a una sola mutación de histona recurrente en un sitio normalmente metilado por una enzima modificadora de histonas. El equipo de Allis ha demostrado que esta histona mutante se une estrechamente a su enzima modificadora, secuestrándola e impidiendo que haga su trabajo normal.

Todo este trabajo ha impulsado los esfuerzos para desarrollar nuevas terapias que se dirijan a estas enzimas modificadoras de histonas, algunas de las cuales se encuentran ahora en uso clínico de rutina, por ejemplo, los inhibidores de enzimas que eliminan los grupos acetilo de las histonas son beneficiosos en cánceres, incluido el linfoma cutáneo de células T y mieloma múltiple, y muchos más se encuentran en investigación clínica para diversas enfermedades.

Los descubrimientos de Grunstein y Allis fueron originales e imprevistos y han transformado nuestra comprensión de la regulación de la expresión génica. Su trabajo también fue valiente, dedicando años de esfuerzo, superando desafíos técnicos desalentadores en sus programas de investigación, mientras nadaba contra una fuerte corriente de un campo avanzado que no preveía la necesidad de un papel para las proteínas histonas en la regulación genética. Además, vale la pena señalar que los descubrimientos de Grunstein y Allis provienen de sus perspicaces selecciones de sistemas experimentales simples para el estudio: levadura y Tetrahymena. Estos sistemas simples han producido innumerables conocimientos fundamentales sobre la biología, lo que nos recuerda que el apoyo público a la investigación impulsada por la curiosidad sigue produciendo conocimientos profundos que, en última instancia, impactan en nuestra comprensión de la salud y la enfermedad humanas. Me complace felicitar a Michael y David por sus espectaculares logros científicos que merecen excepcionalmente el Premio de Investigación Médica Básica Albert Lasker de este año.


Genómica sintética

Desde la primera Conferencia Internacional de Biología Sintética (SB1.0) organizada por el Instituto de Tecnología de Massachusetts (MIT) en 2004 hasta la SB7.0 celebrada en Singapur en 2017, la biología sintética ha entrado gradualmente en la etapa de rápido desarrollo [1]. A principios del siglo XXI, se secuenciaron genomas completos de muchas especies, lo que proporcionó soporte de datos para la síntesis de ADN, lo que dota a los seres vivos de nuevos rasgos genéticos. La genómica sintética incluye muchas técnicas, como la síntesis química, el diseño del genoma, el ensamblaje y el trasplante, con énfasis en el diseño y la síntesis del genoma completo. A medida que el progreso avanza mucho más allá de la biología sintética, se presta cada vez más atención a la investigación científica en genómica sintética.

El desarrollo de la síntesis de ADN.

Inicialmente, la síntesis de ADN pertenece a la "síntesis de replicación", porque el genoma biológicamente activo se sintetiza químicamente sin cambios importantes en su secuencia genómica nativa (Fig. 3) [45,46,47,48,49,50,51,52,53 , 54,55,56,57,58]. La tarea principal en este período fue reconstruir el genoma viral utilizando genética inversa. En 2002, Cello et al. ensambló el ADN complementario (ADNc) de poliovirus de longitud completa utilizando oligonucleótidos sintetizados químicamente de polaridad de hebra positiva y negativa con una longitud de 7,5 kb [45]. Un año después, Smith et al. Sintetizaron químicamente el genoma infeccioso completo de bacteriófagos con una longitud de 5386 pb a partir de un solo grupo de oligonucleótidos ensamblados [46]. Recientemente, los investigadores comenzaron a desafiar la síntesis de genomas a mayor escala, desde unos pocos kb hasta unos pocos cientos de kb, debido al rápido desarrollo de la genómica sintética [47, 48]. En 2008, Gibson et al. sintetizó el genoma de la conocida célula procariota mínima, M. genitalium, cuyo genoma es de 582 kb [49]. Dos años después, el diseño, síntesis y montaje de Mycoplasma mycoides Se completó el genoma JCVI-syn1.0 con 1,08 mega pares de bases (1,08 Mbp) [51].Desde entonces, la genómica sintética entró en la era del “diseño y síntesis” y se diseñaron y reconstruyeron más estructuras del genoma [50]. El trabajo representativo incluye la minimización de Micoplasma genoma, recodificación E. coli genoma y síntesis artificial de S. cerevisiae cromosoma. Especialmente, en 2016, Venter et al. construyó un genoma más pequeño en comparación con el de cualquier célula de replicación autónoma encontrada en la naturaleza al minimizar el genoma sintético de M. mycoides JCVI-syn1.0 (1079 kpb) al JCVI-syn3.0 (531 kbp, 473 genes) [54]. Mientras tanto, Ostrov et al. recodificó el genoma de E. coli y diseñó con éxito un nuevo genoma, que contiene sólo 57 codones [59]. Este trabajo subrayó la viabilidad de reescribir genomas y estableció un marco para el diseño, ensamblaje, resolución de problemas y análisis fenotípico a gran escala de organismos sintéticos. En 2009, Dymond et al. propuso el Proyecto Genoma de Levadura Sintética (Proyecto Sc2.0) [52]. Hasta ahora, seis cromosomas de S. cerevisiae han sido diseñados y sintetizados con éxito [53, 55, 57, 58, 60, 61].

Desarrollo de la genómica sintética

Actualmente, los métodos sintéticos predominantes para la síntesis de ADN son el ADN basado en PCR y basado en ligasa. Para un mejor desarrollo de la genómica sintética, se necesitan nuevas técnicas de síntesis y ensamblaje para satisfacer las crecientes demandas, y muchos grupos de investigación se dedican a este tema. Por ejemplo, se modificó un método de síntesis de ADN (PTDS) basado en PCR y en dos pasos para sintetizar segmentos largos de ADN, lo que implicaba la síntesis de fragmentos individuales de ADN interesado [62]. Los oligonucleótidos de 60 meros con superposición de 20 pb pueden producir un fragmento de ADN de 500 pb, y la amplificación por PCR puede ensamblar la secuencia completa del ADN interesado con dos cebadores más externos. Este método modificado puede producir fragmentos de ADN de 5-6 kb con altos contenidos de G + C en 5-7 días [63]. Luego, se ensambló un método de síntesis precisa (PAS) basado en PCR de secuencias largas de ADN. Además, se añadieron la purificación mediante PAGE y la corrección de errores mediante PCR de superposición-extensión según el método PTDS, lo que dio lugar a fragmentos de ADN más largos de 12 kb en 7 días [64].

La evolución dirigida in vitro es otra poderosa herramienta molecular para diseñar nuevas partes biológicas [65]. Los métodos de síntesis de ADN se utilizan generalmente para investigar la función de las enzimas interesadas. Se aplicó un diseño semirracional y un cribado de alto rendimiento junto con el barajado y el cribado del ADN para la evolución in vitro dirigida para investigar la función de las enzimas informadoras [66, 67]. El rápido crecimiento de la biología sintética en la síntesis de ADN incluye la mejora de fragmentos más largos, mayor precisión y nuevas capacidades, que no solo lee, sino que también edita y reescribe genes y células de organismos.

Genomas mínimos

Otra parte importante de la biología sintética son los genomas mínimos, en los que solo se contiene una secuencia mínima de ADN para el mantenimiento de la vida. El genoma mínimo ideal solo estará compuesto por genes que son esenciales para la supervivencia de organismos en condiciones definidas. Los genes no esenciales y las regiones no codificantes suelen eliminarse, como los elementos genéticos de vías metabólicas alternativas o los que codifican respuestas a situaciones de estrés [54]. Si el chasis microbiano solo contiene el mínimo de genes esenciales, es decir, el genoma mínimo, la producción de los compuestos deseados sería económicamente más factible. Se cree que las células mínimas construidas sobre genomas mínimos pueden servir como plataformas eficientes con nuevas funciones. En contraste con la tecnología recombinante tradicional, la técnica de los genomas mínimos es mucho más avanzada y dirigida, en lugar de la idea de jugar con un puñado de genes para sintonizar una o dos vías metabólicas. La mayoría de ellos adoptó enfoques de arriba hacia abajo para mapear genes esenciales y no esenciales.

En general, el descubrimiento de productos naturales fue un evento de "suerte por casualidad", impulsado por el cribado químico guiado por la bioactividad. Hoy en día, se pueden descubrir nuevos metabolitos secundarios más rápido con mayores capacidades funcionales a través de la minería del genoma. Muchos proyectos completos de secuenciación del genoma han revelado una serie de grupos de genes especializados en la producción de nuevos productos químicos [68]. Por ejemplo, proteobacterias de Burkholderia, Photorhabdus, y Xenorhabdus Se están explorando especies para conocer el alcance total de las capacidades biosintéticas de metabolitos secundarios [69, 70]. Los grupos de genes únicos se pueden cargar como vías heterólogas en un anfitrión o chasis de expresión adecuado para la producción de compuestos de valor agregado. Para ello, es importante comprender la estructura del genoma del chasis en términos de modularidad y esencialidad. Por tanto, se pueden identificar o filtrar los conjuntos mínimos de genes esenciales.


RANKL en inmunidad

La señalización de RANKL es crucial para el desarrollo de varios órganos, incluidos los órganos inmunes. De hecho, RANKL se informó por primera vez como un activador de las células dendríticas expresadas por las células T [4]. Los órganos inmunes consisten en células inmunes y células estromales. Los estudios con ratones han demostrado que varios de estos tipos de células expresan RANKL o RANK, transduciendo señales para el desarrollo y la función del sistema inmunológico como se describe a continuación.

Formación de médula ósea

La médula ósea es uno de los órganos linfoides primarios, donde los linfocitos emergen y maduran. Tanto las células T como las B nacen en la médula ósea y las últimas células maduran en este órgano. Otros tipos de células hematopoyéticas, incluidos los eritrocitos, también residen en este espacio. Debido a que el espacio de la médula ósea se conserva mediante la resorción ósea osteoclástica dentro del hueso, RANKL funciona como un mantenedor de la médula ósea y sus células inmunes residentes. En la mayoría de los tipos de osteopetrosis, los pacientes presentan defectos hematológicos de leves a graves, que pueden provocar anemia, hemorragia y enfermedades infecciosas graves o recurrentes [55, 56].

Desarrollo del timo

El timo es otro órgano linfoide primario en el que los progenitores de las células T se someten a selecciones positivas y negativas para adquirir la propiedad de distinguir los antígenos no propios de los propios, estableciendo así la autotolerancia. Durante la selección negativa, las células que interactúan fuertemente con los autoantígenos expresados ​​en moléculas del complejo principal de histocompatibilidad (MHC) sufren apoptosis [57]. En este proceso, estos antígenos, incluida una parte de los antígenos específicos de tejido (TSA), son expresados ​​por células epiteliales tímicas medulares (mTEC) bajo el control de un factor crucial, el regulador autoinmune (Aire) [58, 59]. RANKL es una citoquina clave para inducir la expresión de Aire en estas células epiteliales, y es proporcionada por células inductoras de tejido linfoide (LTi), timocitos positivos individuales, células T Vγ5 + γδ y células T asesinas naturales invariantes (iNKT) (Fig.2a ) [60,61,62,63]. Debido a que el desarrollo tímico es normal en ratones deficientes en RANKL soluble, se sugiere que el RANKL unido a la membrana en estas células induce el desarrollo de mTEC [17].

RANKL en inmunidad. a Interacción RANKL-RANK en el desarrollo del timo. RANKL es producido por células LTi, células T y células iNKT e interactúa con el RANK expresado en mTEC. Esta interacción induce la expresión de Aire, lo que resulta en la expresión de TSA en moléculas MHC. El complejo TSA-MHC es necesario para la selección negativa, el proceso clave para establecer la auto-tolerancia. B Interacción RANKL-RANK en el desarrollo de los ganglios linfáticos. El desarrollo de los ganglios linfáticos comienza con la interacción entre las células LTi y las células LTo. LTα1β2 es expresado por células LTi e interactúa con LTβR en células LTo, lo que a su vez conduce a la expresión de RANKL en células LTo. El RANKL expresado estimula las células LTi para inducir más LTα1β2, formando un bucle de retroalimentación positiva. Con la estimulación de LTα1β2, algunas células LTo maduran en MRC. El RANKL en las células LTo y los MRC se une al RANK en las células endoteliales linfáticas, lo que resulta en el reclutamiento de macrófagos. C Interacción RANKL-RANK en el tracto gastrointestinal. (Izquierda) Los ILC3 interactúan entre sí a través de RANKL y RANK. La interacción conduce a la disminución de la proliferación y producción de IL-17 / IL-22 de estas células, lo que resulta en la supresión de la inflamación excesiva. (Derecha) Interacción RANKL-RANK en el desarrollo de células M. Las células mesenquimales debajo del epitelio del tracto gastrointestinal expresan RANKL e interactúan con las células epiteliales que expresan RANK. Estas células se diferencian en células morfológica y funcionalmente únicas llamadas células M. Estas células permiten la transferencia de antígenos desde la luz del tracto gastrointestinal a las CD, lo que conduce a la producción de IgA. D Interacción RANKL – RANK en la piel. Los queratinocitos expresan RANKL tras la irradiación UV. El RANKL se une a los LC en la piel. Estas CL contribuyen a la generación de células Treg, que disminuyen la inflamación de la piel y la resolución de la dermatitis en la psoriasis y la dermatitis atópica. mi Interacción RANKL-RANK en la inflamación del SNC. (Izquierda) THLas células de células 17 inducen la expresión CCL20 de astrocitos en la barrera hematoencefálica a través de la señalización RANKL-RANK. CCL20 recluta células que expresan CCR6, incluida la TH17 celdas. Estas células acumuladas penetran la barrera y se infiltran en el SNC para provocar inflamación. (Derecha) En el contexto del accidente cerebrovascular isquémico, las células muertas del cerebro liberan DAMP, que son reconocidos por los TLR. La estimulación de TLR de las células microgliales conduce a la producción de citocinas proinflamatorias que incluyen IL-6 y TNF-α, lo que conduce a inflamación y muerte celular adicional. La señal de RANKL-RANK en las células de la microglía inhibe la producción de estas citocinas, lo que da como resultado la protección del cerebro. RANKL activador del receptor del ligando NF-κB, RANGO activador del receptor de NF-κB, Celda LTi célula inductora de tejido linfoide, celda iNKT Célula T asesina natural invariante, mTEC célula epitelial tímica medular, Aire regulador autoinmune, TSA antígeno específico de tejido, MHC complejo mayor de histocompatibilidad, LTo celda célula organizadora de tejido linfoide, LT linfotoxina, LTβR receptor de linfotoxina β, MRC celda reticular marginal, ILC3 Célula linfoide innata del grupo 3, ILLINOIS interleucina, corriente continua célula dendrítica, UV ultra violeta, LC Celda de Langerhans, Célula Treg célula T reguladora, SNC sistema nervioso central, TH17 celdas T helper 17 celdas, CCL20 Ligando 20 de quimiocina con motivo C-C, CCR6 Receptor 6 de quimiocinas con motivo C-C, HÚMEDO patrón molecular asociado al daño, TLR Receptor tipo peaje

Desarrollo de los ganglios linfáticos

RANKL también contribuye al desarrollo y la función de los órganos linfoides secundarios, donde tienen lugar las respuestas inmunitarias. El LN es uno de esos órganos distribuidos por todo el cuerpo. Los NL consisten en linfocitos y las células estromales circundantes, que establecen una estructura compleja pero bien organizada, con células B y T localizadas en regiones distintas [64]. La organogénesis de LN comienza con la condensación de células LTi, que son CD45 + CD4 + CD3 - IL-7R + RORγt +, y células mesenquimales específicas denominadas células organizadoras de tejido linfoide (LTo). RANKL se expresa en células LTi, células LTo y los descendientes de estas últimas, células reticulares marginales (MRC) [65, 66]. Se informa que la expresión de RANKL en las células estromales de los LN aumenta mediante la señalización del receptor de linfotoxina β (LTβR) [67]. La señal RANKL, más probablemente a través del tipo unido a la membrana [17], induce la maduración de los LN aumentando la celularidad y la atracción de las células inmunes a los LN [6, 65]. Recientemente se informó que el RANKL expresado por las células del linaje LTo estimula las células endoteliales linfáticas para reclutar y mantener macrófagos en los LN (Fig. 2b) [68].

Inmunidad intestinal

El tracto gastrointestinal (GI) es el sitio de entrada de bacterias patógenas más grande, con una superficie 100 veces mayor que la superficie corporal. Para proteger al cuerpo de estas bacterias, el tracto gastrointestinal ha desarrollado un sistema de defensa altamente especializado. Se sabe que los linfocitos que carecen de receptores de antígenos, las células linfoides innatas (CLI), abundan en los tejidos de la mucosa y forman parte de las funciones de barrera secretando citocinas [69, 70]. Las ILC del grupo 3, incluidas las células LTi y las ILC3, expresan un factor de transcripción RORγt y producen una gran cantidad de citocinas IL-17 e IL-22, lo que contribuye a la homeostasis en el intestino [71, 72]. Un estudio reciente informó que las ILC3 se dividen en células NKp46 - CCR6 -, NKp46 + CCR6 - y NKp46 - CCR6 +. La expresión de RANKL y RANK mostró la más alta en las células CCR6 +, que se agrupan dentro de las criptopatías [73, 74]. RANKL [73] suprimió la proliferación y la expresión de IL-17A / IL-22 de los CCR6 + ILC3, lo que indica que estas células interactúan entre sí en los criptoparches para suprimir la proliferación y la inflamación excesivas (Fig. 2c).

Las placas de Peyer (PP) son folículos linfoides debajo del epitelio intestinal. Dentro del epitelio que cubre los PP (epitelio asociado al folículo, FAE), hay un subconjunto de células único, las células M. A diferencia de las células epiteliales circundantes, las células M carecen de vellosidades, pero tienen una estructura de micro pliegues en el lado apical y una estructura en forma de saco (el bolsillo de las células M) en el lado basal. Estas células tienen una alta capacidad de transcitosis, por lo que transfieren las bacterias en el lumen a las CD en el bolsillo de las células M. La presentación de antígenos a las CD a través de las células M da como resultado la respuesta inmune a las bacterias transcitosadas, es decir, la producción de IgA [75]. RANKL es necesario y suficiente para el desarrollo de las células M, y se ha demostrado que su fuente durante el proceso son las células mesenquimales de la lámina propia (Fig. 2c). La deficiencia de RANKL soluble no ha afectado el desarrollo de estas células [76]. El RANKL en estas células mesenquimales también juega un papel en la producción de IgA [14].

Inflamación de la piel

La piel es la primera línea de defensa contra los estímulos externos y, por lo tanto, está equipada con un sistema inmunológico específico. Las células de Langerhans (CL) residen en la epidermis y son uno de los componentes clave de la inmunidad cutánea [77, 78]. Las LC se clasifican como un subconjunto de DC, con dendritas similares a neuronas, una alta capacidad de presentación de antígenos y una capacidad para migrar a los LN, donde las LC presentan antígenos a las células T, generando así células T (Treg) inflamatorias o reguladoras. Se ha demostrado que RANKL es expresado por queratinocitos tras la irradiación ultravioleta (UV) a través de la señal del receptor de prostaglandina E (EP) 4 [79]. El RANKL expresado por los queratinocitos interactúa con RANK en LC, lo que resulta en la expansión de las células Treg. El aumento de las células Treg ejerce efectos inmunosupresores [80], disminuyendo la inflamación excesiva de la piel (fig. 2d). La inmunosupresión inducida por los rayos UV es la base de la fototerapia utilizada para la psoriasis y la dermatitis atópica, pero también puede conducir a la carcinogénesis [81].

Inflamación en el sistema nervioso central.

El sistema nervioso central es un sitio inmunológico privilegiado, que se debe a la presencia de la barrera hematoencefálica (BHE) compuesta por células endoteliales, pericitos y astrocitos. Esta barrera restringe la entrada de células y microorganismos [82]. Un estudio mostró que la penetración de la BHE por patógenos TH17 células en un modelo de ratón con esclerosis múltiple dependían de la señalización RANKL TH17 células que expresan RANKL interactúan con astrocitos que expresan RANK, que a su vez secretan el ligando 20 de quimiocinas del motivo CC (CCL20), lo que atrae aún más las células que expresan el receptor 6 de quimiocinas del motivo CC (CCR6) al sistema nervioso central (SNC) (Fig. 2e) [83].

En el tejido cerebral con accidente cerebrovascular isquémico, hay una inflamación provocada por las células inmunitarias, incluidas las células microgliales, los macrófagos, las CD y las células T γδ [84, 85]. La reducción del flujo sanguíneo en el cerebro conduce a la muerte de las células cerebrales, lo que da como resultado la liberación de patrones moleculares asociados al daño (DAMP) de las células muertas. Estos DAMP incluyen el grupo box-1 de alta movilidad (HMGB1) y peroxiredoxina (Prx), que provocan la ruptura de la BBB y la estimulación de las células inmunitarias anteriores [86]. Los estudios clínicos han observado que la concentración sérica de OPG es mayor en pacientes con ictus isquémico y se correlaciona positivamente con la gravedad [87]. Un estudio mostró que RANKL suprime la producción de citocinas proinflamatorias, como IL-6 y TNF-α, inducidas a través del receptor tipo Toll 4 (TLR-4) (Fig. 2e) [84].

El curso de estos estudios ha revelado que la señal de RANKL funciona en diversos entornos inmunitarios, como la organogénesis, el desarrollo de células inmunitarias y la regulación de su función. Debido a que RANKL sirve a veces beneficioso pero otras veces dañino, la modulación de esta citoquina puede ser de utilidad terapéutica en enfermedades que afectan al sistema inmunológico. Se necesitan estudios cuidadosos para evitar la posible aparición de efectos secundarios.


Diafonía y cooperación de vías de mecanotransducción.

Varias publicaciones han identificado diafonía y cooperación entre las vías de detección mecánica cubiertas por esta revisión (Fig. 3c). YAP regula negativamente la expresión de miocardina así como su asociación con SRF para controlar el cambio fenotípico de las células del músculo liso vascular en respuesta a la estimulación con factor de crecimiento derivado de plaquetas. La sobreexpresión de YAP inhibió la expresión génica contráctil que incluía α-SMA, SM22α, SMMHC y MYOCD en sí mismo, al tiempo que promueve la transcripción de genes pro-proliferativos [122]. Se encontró que YAP interactúa específicamente con la miocardina, lo que reduce su co-inmunoprecipitación con SRF, reduciendo así la transcripción dirigida por SRF de genes del músculo liso (Fig. 3c). Por tanto, YAP juega un papel funcional en el control del fenotipo de las células del músculo liso vascular de una manera dependiente de la miocardina. Esto es funcionalmente relevante en respuesta a la lesión vascular (p. Ej., Formación de lesión vascular inducida por lesión por balón) en la que se induce la expresión de YAP [122]. En estas condiciones, YAP actúa como un regulador negativo de la transcripción génica mediada por SRF. Sin embargo, en otro estudio se encontró que YAP y MRTF-A cooperan para promover la transcripción génica estimulada por GPCR / RhoA y la proliferación celular [123] (Fig. 3c). Derribo de YAP o MRTF-A bloqueó la inducción de CCN1 (Cyr61) expresión estimulada por la activación de GPCR mediada por S1P en células de glioblastoma. Al igual que la miocardina, se encontró que MRTF-A se asocia con YAP en experimentos de co-inmunoprecipitación después de la estimulación con GPCR. Funcionalmente, tanto YAP como MRTF-A se unen al promotor CCN1 para impulsar la proliferación de células de glioblastoma estimuladas por S1P [123]. De acuerdo con esto, un artículo reciente de Cui et al.[93] informaron que la eliminación de MRTF-A o YAP bloqueaba la propagación cíclica estimulada por estiramiento y la proliferación de fibroblastos embrionarios primarios de ratón en superficies blandas. Curiosamente, la eliminación de YAP o MRTF-A impidió la localización nuclear de la otra proteína en respuesta al estiramiento cíclico, aunque el mecanismo de esta regulación aún no se ha dilucidado.

Más recientemente, dos informes identificaron un vínculo entre MRTF y TAZ [124, 125]. La señalización MRTF / SRF promueve TAZ expresión génica y abundancia de proteínas aguas abajo de la activación por herregulina β1 en células de cáncer de mama [124]. De manera similar, la caída de MRTF en una línea celular de riñón porcino dio como resultado una importante regulación a la baja del ARNm y la proteína de TAZ [125]. Al igual que en informes anteriores que encontraron que los MRTF podrían interactuar directamente con YAP, Speight et al. [125] demostró que TAZ y MRTF se asocian, al menos en parte, por la interacción mediada por dominio WW / PPxY [126, 127]. Sin embargo, es importante destacar que los autores demostraron elegantemente que, a pesar de su interacción, MRTF y TAZ se trasladan de forma independiente al núcleo tras la polimerización de actina [125]. De hecho, en un esquema interesante y complejo de diafonía de proteínas, TAZ y MRTF mitigan recíprocamente la localización y acumulación nuclear del otro inducida por niveles bajos de calcio (Fig. 3c). Se supone que esta observación está mediada por la interacción TAZ-MRTF, que puede secuestrar ambas proteínas en el citoplasma. Además, se encontró que MRTF regulaba positivamente la expresión de 14-3-3, que se espera que aumente el secuestro citoplasmático tanto de TAZ como de YAP [125]. La diafonía entre estos cofactores transcripcionales es significativa a la luz del conocimiento de que la interacción de TAZ y MRTF puede tener diferentes resultados transcripcionales. Específicamente, TAZ y MRTF se antagonizan entre sí en el promotor α-SMA, mientras que se sinergizan en elementos TEAD que no están ubicados directamente en una secuencia SRE / CArG [125].

La heregulina β1 (una isoforma de corte y empalme de la neuregulina 1) es una proteína soluble que se une a la proteína receptora tirosina quinasa ERBB4 y la activa. Tras la activación, el dominio citoplasmático intracelular (ICD) de ERBB4 se transloca al núcleo donde puede activar la transcripción. A través de una interacción mediada por dominio WW / PPxY, YAP interactúa con ERBB4 ICD para estimular la transcripción [128]. Más tarde se demostró que esta interacción, que produce un complejo tripartito YAP-TEAD-ERBB4, induce genes diana YAP como CTGF, y promovió la migración celular dependiente de YAP en respuesta al tratamiento con neurregulina en células de carcinoma mamario [129]. Curiosamente, las proteínas tirosina quinasas (incluida ERBB4) están principalmente involucradas en la formación de adherencias focales y detección de rigidez (revisado en [130]). La eliminación de ERBB4 en fibroblastos humanos cultivados redujo significativamente la polarización celular dependiente de la rigidez, caracterizada por un alargamiento celular reducido y alineación de adhesión focal, pero con un mayor número de adhesión focal, tanto en sustratos blandos como rígidos [131]. Estos hallazgos revelan que la activación de ERBB4 a través de señales químicas (señalización de heregulina β1 / neuregulina) o mecánicas (rigidez) puede alterar la señalización de YAP / TAZ a través de dos mecanismos diferentes. Por lo tanto, ERBB4 debe considerarse un regulador clave de la actividad de YAP / TAZ.

Como se discutió anteriormente, MRTF se asocia con Smad3 para conducir babosa expresión [27]. Curiosamente, Smad3 inhibe la activación dependiente de MRTF del promotor α-SMA al reducir la asociación de MRTF con SRF [132] (Fig. 3c). También se ha informado que TAZ coopera con Smad3 para impulsar la expresión de α-SMA, y en una capa adicional de complejidad, el tratamiento con TGFβ alteró la interacción relativa entre MRTF, Smad3 y TAZ [125]. Esto es significativo ya que TGFβ es un potente inductor bioquímico de fibrogénesis, mediado por la señalización de MRTF descendente, por lo que la abundancia relativa de estos mediadores de señalización múltiple, además de los estímulos mecánicos y químicos detectados por las células, dictará con precisión la respuesta a nivel de la transcripción de genes.

Como otro ejemplo de diafonía entre las vías de detección mecánica, se identificó que la β-catenina es un regulador positivo de la señalización de MRTF mediante el alivio de la inhibición de Smad3 a través de dos mecanismos [133] (Fig. 3c). Primero, la β-catenina compite con Smad3 por la unión de MRTF, liberando MRTF para que se asocie con SRF. En segundo lugar, la β-catenina suprime el reclutamiento mediado por Smad3 de glucógeno sintasa quinasa-3β a MRTF que conduce a su ubiquitinación y degradación, aumentando así la estabilidad de la proteína MRTF [133]. Curiosamente, YAP y β-catenina cooperan para regular la proliferación celular inducida por tensión mecánica [134]. La reentrada en el ciclo celular y la progresión posterior de la fase G1 a la S están mediadas por la señalización de YAP y β-catenina, respectivamente, sin embargo, la inhibición de cualquiera de ellas es suficiente para bloquear la proliferación celular determinada por la incorporación de Edu. En particular, el tratamiento con inhibidores para bloquear la actividad de YAP (p. Ej., Péptido inhibidor de YAP1-TEAD o verteporfina) también bloqueó la entrada al ciclo celular, evidenciada por una marcada reducción en la tinción positiva para Ki67 [134]. Así, a través de roles diferentes pero complementarios, YAP y β-catenina se coordinan para regular la función biológica (Fig. 3c).


Tumores asociados al VEB

Enfermedad linfoproliferativa en inmunosupresión

Las linfoproliferaciones que surgen después de la inmunosupresión iatrogénica para la cirugía de trasplante se conocen colectivamente como trastornos linfoproliferativos postrasplante (PTLD). Se observan tumores similares en pacientes con ciertas formas de síndromes de inmunodeficiencia hereditaria, como el síndrome linfoproliferativo ligado al cromosoma X y el síndrome de Wiscott-Aldrich, y en pacientes con SIDA. La mayoría de las veces son de origen de células B y representan una familia de lesiones que van desde las proliferaciones de células B policlonales atípicas, que a menudo retroceden después de la retirada o reducción de la inmunosupresión, hasta los linfomas no Hodgkin (LNH) monomórficos agresivos, que generalmente no lo hacen. se resuelven tras la reconstitución inmunitaria (Niedobitek y Young, 1997).

La incidencia y la presentación clínica de los ELPT varía con el órgano trasplantado, la duración de la inmunosupresión y la dosis y el número de agentes utilizados, aunque hay una serie de características clínicas comunes, que incluyen su aparición frecuente en múltiples localizaciones extraganglionares como el tracto gastrointestinal. tracto o incluso en el propio órgano del aloinjerto. La alta incidencia de ELPT en el órgano trasplantado sugiere que la estimulación antigénica crónica en el injerto podría ser importante en la patogenia de estas lesiones. De hecho, las células T son necesarias para el desarrollo de tumores similares a PTLD en ratones inmunodeficientes combinados graves (SCID), lo que sugiere un papel importante para la ayuda de las células T en el crecimiento de PTLD derivados de células B (Johannessen et al., 2000 ).

La mayoría de los casos de ELPT son EBV positivos y muchos muestran un patrón Lat III de expresión génica (Young et al., 1989). Por tanto, en muchos casos, los PTLD parecen representar la en vivo contraparte de in vitro LCL inmortalizados y, por implicación, es probable que sean impulsados ​​principalmente por el VEB. Sin embargo, ocasionalmente se observan otras formas de latencia (es decir, Lat I y Lat II) y se han descrito formas EBV negativas de PTLD, que incluyen algunos tumores de células T. Estos tumores EBV negativos tienden a ser monomórficos, se presentan más tarde que los tumores EBV positivos y son más agresivos (Dotti et al., 2000 Nelson et al., 2000). Curiosamente, una proporción de estos tumores responde a una disminución de la inmunosupresión, lo que podría sugerir la participación de otros agentes virales.

Linfoma de burkitt

El reconocimiento de que BL en África aparentemente estaba restringido a áreas donde la infección por Plasmodium falciparum la malaria era holoendémica, lo que llevó a la sugerencia de que podría estar involucrado un agente infeccioso y, finalmente, al descubrimiento del VEB por parte de Epstein, Achong y Barr. La denominada forma "endémica" o de alta incidencia de LB se produce con una incidencia anual de aproximadamente 5 a 10 casos por 100 000 niños en África ecuatorial y partes de Papua Nueva Guinea. Por el contrario, los casos esporádicos de LB ocurren en todo el mundo, pero con una frecuencia mucho menor (al menos 50 veces menos que en las áreas de alta incidencia).

Mientras que prácticamente todos los tumores BL encontrados en las regiones de alta incidencia son EBV positivos, sólo alrededor del 15% de los tumores BL esporádicos portan el virus (Rickinson y Kieff, 2001). Además, ciertas áreas de "incidencia intermedia" fuera de las regiones de malaria holoendémica, como Argelia y Egipto, han aumentado el número de casos que se correlacionan con una mayor proporción de tumores positivos para el VEB. El BL también se observa como consecuencia de la infección por VIH, que ocurre con frecuencia antes del desarrollo del SIDA en toda regla. Sólo 30 a 40% de los casos de SIDA-BL están asociados con el VEB. Una característica constante de todos los tumores BL, independientemente de la ubicación geográfica o la asociación con el SIDA, son las translocaciones cromosómicas que involucran el brazo largo del cromosoma 8 (8q24) en la región de la c-mi c protooncogén y el cromosoma 14 en la región del gen de la cadena pesada de la inmunoglobulina o, con menos frecuencia, los cromosomas 2 o 22 en la región de los genes de la cadena ligera de la inmunoglobulina. Esta translocación da como resultado la expresión desregulada de la c-mi c oncogén.

El papel preciso del VEB en la patogenia del BL aún no se ha establecido, aunque la detección de episomas del VEB monoclonales en biopsias de BL con virus positivos sugiere que la infección por VEB precedió a la proliferación de las células B precursoras (Neri et al., 1991). El origen aparente de LB en el centro germinal se basa en estudios fenotípicos y está respaldado por la capacidad de los factores de riesgo de LB como la malaria holoendémica y la infección crónica por VIH para estimular la proliferación de células B en el centro germinal (Rowe et al., 1987) . Estas células también están programadas para sufrir una mutación somática de genes de inmunoglobulina y este evento, junto con la estimulación de la proliferación del centro germinal y la infección por EBV, podría ser responsable de la generación y selección de células B portadoras de la c-mi c translocación.

Las células BL de tejidos primarios parecen mostrar un patrón muy restringido de expresión génica viral, donde EBNA1 es aparentemente la única proteína EBV detectable de manera consistente (Hatzubai et al., 1987 Gregory et al., 1990). Aunque algunos informes han documentado la expresión de LMP1 y EBNA2 en pequeñas cantidades de células en unos pocos casos de BL endémico (Niedobitek et al., 1995), y LMP1 en varios casos de BL esporádico (Carbone y Gloghini, 1995), esto no parece ser una ocurrencia frecuente. Cuando las células de algunos tumores BL positivos para EBV se pasan en cultivo, los otros EBNA y LMP se expresan, y los antígenos de superficie celular inducidos por EBNA2 y LMP1, como CD23, CD30, CD39, LFA1, LFA3 e ICAM1, también son regulado al alza (Gregory et al., 1990). EBNA2 y LMP1 son los principales mediadores del crecimiento de linfocitos B inducido por EBV in vitro y la falta de expresión de estas proteínas en las células tumorales sugiere que no son necesarias para el mantenimiento de los tumores BL. La expresión alterada de MYC puede reemplazar la proliferación celular impulsada por EBV y permitir que las células sobrevivan y proliferen con la regulación a la baja de los EBNA y LMP, lo que a su vez puede permitir que las células infectadas eviten la inmunovigilancia CTL (Rowe et al., 1987). Esto puede explicar por qué la deriva a un fenotipo LCL visto en algunas líneas BL in vitro ocurre solo a un nivel bajo en vivo (Carbone y Gloghini, 1995 Niedobitek et al., 1995), ya que las células "derivadas" serían eliminadas selectivamente por la respuesta CTL. Líneas BL positivas para EBV que han retenido el fenotipo de células tumorales in vitro no son sensibles a la lisis por CTL específicos de EBV. Además de la regulación a la baja de los EBNA y LMP altamente inmunogénicos, varias características fenotípicas contribuyen a disminuir la inmunogenicidad de las células tumorales BL. Estos incluyen expresión reducida de moléculas de adhesión celular y una regulación a la baja general y selectiva de alelos de la expresión del MHC de clase I (Rickinson et al., 1992), defectos en el procesamiento de antígenos (de Campos-Lima et al., 1993) y transporte de péptidos ( Khanna y col., 1994).

La evidencia de que el VEB y la expresión alterada de MYC pueden cooperar para alterar el crecimiento de los linfocitos B proviene de estudios en los que se utilizó el VEB para transformar los linfocitos B humanos in vitro, seguido de la introducción de un gen MYC reordenado, clonado a partir de una línea celular BL, en estas células (Lombardi et al., 1987). Las células transformadas con EBV inicialmente tenían eficiencias de clonación muy bajas en agar blando y no formaron tumores en ratones desnudos, pero después de la transferencia génica de un MYC reordenado, crecieron más eficientemente en agar blando y fueron tumorigénicas. Se demostró que el gen MYC activado introducido en una línea celular transformada por EBV en la que EBNA2 se volvió dependiente de estrógenos era capaz de inducir la proliferación continua de estas células en ausencia de LMP1 y EBNA2 funcionales, lo que sugiere que MYC podría sustituir a LMP1 y EBNA2 en Células progenitoras de BL (Polack et al., 1996).

La evidencia reciente también sugiere una mayor participación del VEB en BL esporádico que lo documentado previamente. Por tanto, se han detectado genomas de VEB defectuosos reorganizados en algunos tumores BL esporádicos de los EE. UU. (Razzouk et al., 1996). Tales reordenamientos virales pueden conducir a la expresión constitutiva del gen temprano inmediato BZLF-1, que por transfección transitoria se ha demostrado que da como resultado la eliminación parcial de los episomas de EBV de las células infectadas. Por lo tanto, la presencia de estos genomas defectuosos puede pasar desapercibida por las pruebas de EBV convencionales (por ejemplo, EBER en el lugar hibridación), y sugiere un proceso de reordenamiento y pérdida del ADN viral durante la progresión maligna consistente con un papel de "golpe y fuga" del EBV en la patogénesis de al menos una proporción de casos esporádicos de BL.

Enfermedad de Hodgkin

Ya en 1966 MacMahon había propuesto que la EH podría ser causada por un agente infeccioso (MacMahon, 1966). La primera evidencia de que este agente podría ser el VEB fue proporcionada por la detección de títulos elevados de anticuerpos contra los antígenos del VEB en pacientes con EH en comparación con otros pacientes con linfoma (Levine et al., 1971) y, además, que estos niveles elevados precedieron al desarrollo de EH. por varios años (Mueller et al., 1989). Además, se demostró que el riesgo relativo de desarrollar HD en individuos con antecedentes de MI, en relación con aquellos sin antecedentes previos, oscila entre 2,0 y 5,0 (Gutensohn y Cole, 1980). Weiss y col. (1991) fueron los primeros en demostrar la presencia de ADN de EBV en muestras de tejido de HD utilizando el clon BamFragmento HI W de EBV, como en el lugar sonda de hibridación. El posterior desarrollo de en el lugar La hibridación para apuntar a las EBER altamente abundantes proporcionó un método confiable y simple para la detección de EBV en muestras de archivo HD (Wu et al., 1990). Varios investigadores han demostrado la clonalidad del VEB en tejido de HD mediante hibridación con los TR virales (Anagnostopoulos et al., 1989). Estos hallazgos indican la expansión clonal de células individuales infectadas por el VEB y subrayan además un posible papel etiológico del VEB en una proporción de casos de HD. Los ensayos inmunohistoquímicos (Figura 2) y el análisis transcripcional en biopsias recientes han demostrado que las células malignas de Hodgkin / Reed-Sternberg (HRS) de los casos EBV positivos expresan altos niveles de LMP1 en ausencia de expresión de EBNA2 (patrón Lat II) (Pallesen et al. al., 1991 Murray et al., 1992 Deacon et al., 1993).

Detección de productos génicos del VEB en la EH. Panel superior (a) muestra la detección de los ARN codificados por EBV (EBER) altamente abundantes utilizando en el lugar hibridación. La expresión de EBER se restringe principalmente a los núcleos de las células HRS infectadas. (B) Expresión de LMP1 utilizando el reactivo monoclonal CS1-4. LMP1 casi siempre es detectable en las células HRS de la EH asociada a EBV. (C) LMP2 también es detectable en células HRS de casos asociados con EBV. Se muestra una sola célula HRS positiva para LMP2

El VEB es detectable con regularidad en hasta la mitad de todos los tumores de EH de países desarrollados y en una mayor proporción de los casos que surgen en comunidades en desarrollo. Las sorprendentes diferencias epidemiológicas y clínicas apuntan a importantes diferencias subyacentes en la etiología y el comportamiento de las formas de HD con EBV positivo y EBV negativo. Por lo tanto, el VEB se asocia preferentemente con la forma de celularidad mixta de la EH y también con los hombres en lugar de las mujeres. La EH con EBV positivo también afecta a más asiáticos e hispanos que a blancos o negros (Glaser et al., 1997). Estudios recientes del Reino Unido también muestran una fuerte asociación entre la positividad al VEB y la etnia del sur de Asia en pacientes pediátricos con HD (Flavell et al., 2001).

Se ha demostrado que la EH en pacientes mayores (& gt55 años de edad) y en niños, especialmente niños menores de 10 años, tiene más probabilidades de estar asociada con el VEB que la EH en adultos jóvenes (Armstrong et al., 1998). Esto ha llevado a la sugerencia de que la HD consta de tres entidades de enfermedad: HD de la infancia (EBV positivo, tipo MC), HD de adultos jóvenes (EBV negativo, tipo NS) y HD de adultos mayores (EBV positivo, tipo MC) (Armstrong et al., 1998). Si bien una respuesta inusual a la infección primaria por VEB podría explicar la incidencia de casos de EH con virus positivos en niños, la asociación del VEB con el tumor en pacientes mayores podría reflejar un aumento de la actividad del VEB como resultado de la falta de inmunidad de las células T. A este respecto, la incidencia global de HD aumenta marginalmente en pacientes con SIDA, pero la mayoría de los tumores de HD que surgen en pacientes con SIDA están asociados con el VEB (Uccini et al., 1990).

Estos grupos de edad parecen ser importantes cuando se considera el impacto del estado del VEB en el resultado de los pacientes en HD. Por tanto, en los adultos jóvenes, parece haber una ventaja pronóstica marginal cuando los pacientes portan el genoma del VEB en su tumor (Glavina-Durdov et al., 2001). Sin embargo, en los adultos mayores (Clarke et al., 2001) y en los niños (Flavell et al., 2001), la presencia de EBV en el tumor conlleva un peor pronóstico. Por tanto, la influencia del VEB en la supervivencia en la EH podría reflejar diferencias en estas diferentes edades en el equilibrio entre la respuesta inmunitaria a las células tumorales infectadas por el virus y la capacidad oncogénica del virus. La presencia de VEB también puede reflejar, en general, un estado inmunológico deficiente, lo que a su vez significa que los pacientes podrían tolerar peor la enfermedad y su tratamiento.

LMP1 tiene efectos importantes en las células B y su alto nivel de expresión en las células HRS infectadas por EBV sugiere que es probable que sea responsable de algunas de las diferencias observadas entre las formas de HD positivas y negativas al virus. Estudios que han intentado mostrar una correlación entre LMP1 y la expresión de muchos de los genes que se sabe que están regulados positivamente por LMP1 in vitro han demostrado que tales diferencias existen en las células primarias de HRS. Por ejemplo, ciertos genes regulados por LMP1, como IL-10 y TRAF1, se expresan más en la EH con EBV positivo en comparación con la HD EBV negativa (Herbst et al., 1996 Durkop et al., 1999 Murray et al., 2001 ).

Aunque la HD con EBV positivo y EBV negativo puede representar puntos finales morfológicos similares, los medios por los cuales esto se logra pueden ser diferentes. Por tanto, NF constitutivaκLa activación de B se ha detectado consistentemente en células HRS (Bargou et al., 1996) y NF-κLa expresión de B se puede observar en células HRS mediante inmunohistoquímica en tumores EBV positivos y negativos (Murray, no publicado). Inhibición de NF-κLa actividad B en las líneas celulares de la EH conduce a su mayor sensibilidad a la apoptosis después de la abstinencia del factor de crecimiento y al deterioro de la tumorigenicidad en ratones con inmunodeficiencia combinada grave (SCID) (Bargou et al., 1997). Aunque NF-κLa activación B es una característica común de las células HRS, las rutas moleculares para esta activación pueden ser diferentes entre la HD EBV positiva y EBV negativa. Por tanto, mediante PCR unicelular de células HRS, Jungnickel et al. (2000) detectaron mutaciones clonales en el IκBα gen en 2/3 casos de EH EBV negativo, pero no se detectaron tales defectos en los dos casos EBV positivos examinados. Esto sugiere que la activación constitutiva de NF-κB por LMP1 en células HRS positivas para EBV podría ser sustituido por IκBα mutaciones genéticas en células HRS no infectadas por EBV. Se requieren más estudios sobre un mayor número de casos para corroborar esto.

Aunque el VEB normalmente persiste durante el curso de la EH y también se encuentra en múltiples sitios de la EH (Coates et al., 1991), se ha informado la EH EBV negativa que surge como una recaída de un tumor de EH anteriormente positivo para el VEB (Nerurkar et al. ., 2000). La posibilidad de que el VEB pueda contribuir a la tumorigénesis mediante un mecanismo de "golpe y fuga", similar al ya descrito para BL, ha impulsado la búsqueda de pruebas de ADN del VEB reordenado defectuoso en tumores que, mediante pruebas convencionales (p. Ej., Utilizando EBER en el lugar hibridación), son ostensiblemente negativos al virus. Los resultados de estos estudios son algo contradictorios. En un estudio, Gan et al. (2002) buscaron la presencia de genomas de VEB reorganizados defectuosos en la EH utilizando tanto PCR estándar como PCR en el lugar hibridación. Ellos amplificaron con éxito secuencias que se extienden anormalmente yuxtapuestas BamFragmentos H1W y Z (que caracterizan el ADN de EBV heterogéneo defectuoso) de dos de los 24 tumores negativos para EBER en los que no se pudo detectar el genoma viral estándar. Sin embargo, en otro estudio, la fluorescencia en el lugar El análisis de hibridación (FISH) no encontró evidencia de genomas de VEB integrados en tumores de HD negativos para VEB (Staratschek-Jox et al., 2000).

Linfomas de células T

El VEB se ha relacionado con proporciones variables de LNH de células T de estos, se ha informado una incidencia muy alta de genomas de VEB en LNH-T nasosinusales que ocurren en pacientes japoneses, chinos, peruanos, europeos y estadounidenses (Niedobitek y Young, 1997 Rickinson y Kieff, 2001). Los LNH-T sinonasales muestran características fenotípicas y genotípicas peculiares, que incluyen la ausencia frecuente de antígenos de células T, expresión de marcadores de células NK y la ausencia de reordenamientos del gen del receptor de células T.

Un aspecto intrigante de los linfomas de células T con EBV positivo es la detección frecuente del virus en solo una fracción (5-50%) de las células tumorales, lo que implica que la infección por EBV podría haber ocurrido después del desarrollo del tumor (Niedobitek y Young, 1997). . El aumento documentado en la proporción de células tumorales positivas para EBV con progresión o recurrencia del linfoma de células T sugiere que el virus podría proporcionar una ventaja adicional de crecimiento / supervivencia a las células T transformadas.

La mayoría de los LNH-T asociados al VEB son extraganglionares y tienen un fenotipo citotóxico, como lo demuestra la tinción inmunohistoquímica para el antígeno 1 intracitoplasmático de células T (TIA-1) y la granzima B (Brink et al., 2000), lo que sugiere que estos tumores podrían surgen después de la infección por el VEB de los CTL durante la destrucción de las células infectadas por el VEB por los CTL específicos del virus. Curiosamente, las células B positivas para el VEB se detectan con frecuencia en algunos linfomas de células T negativas para el VEB y, a diferencia de los linfocitos pequeños positivos para el VEB detectables en UNPC o HD, estas células muestran un fenotipo lat III, lo que sugiere que la presencia de la Las células T neoplásicas podrían ser un estímulo para la transformación de células B inducida por EBV (Niedobitek et al., 2000). Otra posibilidad es que las células B infectadas con EBV presentes en los linfomas de células T podrían contribuir al crecimiento de las células T neoplásicas, posiblemente por la secreción de citocinas o quizás más directamente por la interacción de sus moléculas coestimuladoras con moléculas asociadas en las células T .

El carcinoma nasofaríngeo

El tumor que muestra la asociación mundial más consistente con el VEB es la forma indiferenciada de carcinoma nasofaríngeo (UNPC tipo III de la OMS). El UNPC se caracteriza por la presencia de células de carcinoma indiferenciadas junto con un infiltrado linfocítico prominente, este último se cree que es importante para el crecimiento de las células tumorales. Ya en 1966 se sugirió un vínculo entre el VEB y el UNPC sobre la base de estudios serológicos, y más tarde se confirmó mediante la demostración del ADN del VEB y el complejo EBNA en las células tumorales de los CPNU utilizando en el lugar hibridación y el ensayo de inmunofluorescencia anticomplemento (ACIF) (zur Hausen et al., 1970). La hibridación por transferencia Southern de ADN de tejidos UNPC reveló la monoclonalidad de los genomas virales residentes, lo que sugiere que la infección por EBV había tenido lugar antes de la expansión clonal de la población de células malignas (Raab-Traub y Flynn, 1986).

La UNPC es particularmente común en áreas de China y Asia Sudoriental, alcanzando una incidencia máxima de alrededor de 20-30 casos por 100 000. Las tasas de incidencia también son altas en personas de ascendencia china independientemente de dónde vivan, y particularmente en los hombres cantoneses. Además de esta predisposición genética, se cree que los cofactores ambientales como los componentes de la dieta (es decir, pescado salado) son importantes en la etiología de la NPC (Yu et al., 1986). La evidencia experimental que respalda el papel de las nitrosaminas como constituyente del pescado salado en el desarrollo de NPC es proporcionada por la observación de que las ratas albinas alimentadas con una dieta de pescado salado desarrollan carcinoma de la cavidad nasal (Huang et al., 1978).

El cribado serológico extenso ha identificado títulos elevados de anticuerpos específicos del VEB en áreas de alta incidencia, en particular, anticuerpos IgA contra el antígeno de la cápside del VEB (VCA) y los antígenos tempranos (EA), y estos han demostrado ser útiles en el diagnóstico y en el seguimiento de la eficacia de la terapia. (Zeng, 1985).

EBNA1 y EBERs (Figura 3a) se expresan en todos los casos EBV-positivos y LMP1 está presente en hasta aproximadamente 65% de los casos (Young et al., 1988 Niedobitek et al., 1992), aunque la detección de LMP1 en un determinado tumor depende en parte de la sensibilidad del método utilizado La RT-PCR identifica más casos positivos que la inmunohistoquímica (Figura 3b). Los estudios de PCR también han revelado la expresión de LMP2A, aunque la proteína LMP2A aún no se ha detectado en tumores NPC (Brooks et al., 1992).

Detección de la expresión de genes virales en neoplasias epiteliales asociadas al VEB. El panel (a) muestra la expresión típica de EBER en un tumor NPC indiferenciado, mostrando tinción marrón de núcleos malignos por en el lugar hibridación para los EBER. La abundante infiltración linfocítica circundante característica de este tumor no está teñida y aparece de color azul. El panel (b) muestra la expresión de LMP1 del mismo tumor. Sin embargo, a diferencia de la EH, no todos los casos de UNPC expresan LMP1. La expresión de LMP2 a nivel de proteína aún no se ha demostrado en UNPC, aunque se puede detectar la transcripción de LMP2. El panel (c) muestra un adenocarcinoma gástrico positivo para EBV pobremente diferenciado. Las células de carcinoma positivas para EBV se destacan mediante la detección de los EBER (tinción marrón). Tenga en cuenta que estos tumores también suelen tener un infiltrado linfocítico prominente

La asociación del VEB con las otras dos formas (tipos I y II de la OMS) de NPC es controvertida. El ADN viral es detectable en extractos de NPC de células escamosas mediante hibridación por transferencia Southern (Raab-Traub et al., 1987), aunque en estos casos no se pudo determinar la clonalidad de los episomas virales. La mayoría en el lugar Los estudios de hibridación no han podido detectar el ADN del VEB o los EBER en NPC de células escamosas, y la PCR solo identifica el ADN de EBV en una pequeña proporción de NPC de células escamosas, lo que sugiere que el VEB está presente solo en los linfocitos B reactivos en estas lesiones. Sin embargo, un informe ha demostrado la expresión de los EBER en los 31 NPC escamosos (Pathmanathan et al., 1995).

Carcinomas indiferenciados de tipo nasofaríngeo

Se han descrito carcinomas con características similares a UNPC en otros sitios, incluidos el timo, las amígdalas, los pulmones, el estómago, la piel o el cuello uterino, y a menudo se denominan carcinomas indiferenciados de tipo nasofaríngeo (UCNT) o "linfoepiteliomas". Las similitudes morfológicas de los UCNT con los UNPC llevaron a varios grupos a examinar estos casos para detectar la presencia de VEB. Los UCNT del estómago son consistentemente positivos para EBV (Shibata et al., 1991), mientras que la asociación de los otros UCNT con EBV es menos fuerte. El VEB se ha demostrado en tumores epiteliales tímicos de pacientes chinos pero no occidentales (Fujii et al., 1993). Los UCNT de las glándulas salivales están asociados con el VEB en los esquimales de Groenlandia y los chinos, pero no en las pacientes caucásicas (Raab-Traub et al., 1991), y varios informes de casos han demostrado la ausencia de EBV de los UCNT que surgen en el cuello uterino y la mama (Weinberg et al. ., 1993 Dadmanesh et al., 2001).

Carcinoma gástrico

El VEB también se encuentra en una pequeña proporción de adenocarcinomas gástricos más típicos (Figura 3c) de tipo difuso o intestinal (Shibata y Weiss, 1992 Rowlands et al., 1993 Tokunaga et al., 1993). Sin embargo, las características histológicas de estos carcinomas gástricos diferenciados más típicos pueden mostrar heterogeneidad, y algunos casos tienen un crecimiento tumoral similar al linfoepitelioma junto al tumor de adenocarcinoma (Rowlands et al., 1993 Gulley et al., 1996), lo que hace que la distinción histológica entre tumores sea más Complicado. Los estudios inmunohistoquímicos de carcinomas gástricos asociados a virus (que incluyen tanto UCNT como adenocarcinomas) han mostrado un patrón de expresión restringido limitado a los EBER, EBNA1 y BZLF1, pero no a LMP1 u otros EBNA (Imai et al., 1994 Sugiura et al., 1996).

Los cánceres gástricos positivos para VEB son más probables en hombres que en mujeres (Shibata y Weiss, 1992 Tokunaga et al., 1993), y es menos probable que se encuentren en el antro gástrico que en el cardias o el cuerpo del estómago (Tokunaga et al. , 1993 Yuen et al., 1994 Galetsky et al., 1997), y es más probable que sean tumores poco diferenciados (Yuen et al., 1994 Gulley et al., 1996 Shin et al., 1996 Galetsky et al., 1997) . Se han encontrado asociaciones menos consistentes para la edad, con algunos estudios que encuentran más tumores EBV positivos en personas mayores, 60+ años (Qiu et al., 1997) o 56+ años (Gulley et al., 1996). Recientemente, se ha demostrado que el carcinoma gástrico EBV positivo es más común en tumores de hispanos de Texas que de blancos no hispanos o afroamericanos (Vo et al., 2002), lo que refuerza la opinión mantenida desde hace mucho tiempo, que sorprendentemente nunca se ha probado adecuadamente. , que la asociación del VEB en el carcinoma gástrico varía con la etnia.

¿El VEB está asociado con otras neoplasias epiteliales comunes?

Detección de las EBER por en el lugar la hibridación se ha convertido en el método estándar para detectar la infección por VEB en tejidos tumorales procesados ​​de forma rutinaria. Aunque se cree que los EBER se expresan en todas las formas de latencia, dos estudios han sugerido la posibilidad de formas de latencia negativas para EBER y que tales formas de latencia podrían existir en neoplasias malignas asociadas al VEB hasta ahora no reconocidas. En el primero de ellos, la detección de EBV en una proporción de tumores de mama clásicos se informó mediante PCR, inmunohistoquímica para la proteína EBNA1 y transferencia de Southern (Bonnet et al., 1999). Sin embargo, la expresión de EBER no fue detectable por en el lugar hibridación. El VEB también se detectó con mayor frecuencia en los tumores de mama que eran receptores de hormonas negativos y de alto grado histológico. En el segundo estudio, el VEB se informó en una serie de carcinomas hepatocelulares (HCC) nuevamente en ausencia de expresión de EBER (Sugawara et al., 1999). Además, se identificó un fragmento de un solo terminal de ADN de EBV en estos tejidos, lo que sugiere que las células infectadas con EBV en HCC representan proliferaciones clonales. La transferencia de Western y la reacción en cadena de la polimerasa con transcripción inversa también demostraron la expresión de EBNA1 y la BamTranscripciones de HI A. Más recientemente, los resultados de Grinstein et al. (2002), utilizando el anticuerpo monoclonal 2B4-1 y la PCR basada en secciones completas, pareció sugerir que el VEB también está presente en una proporción de otras neoplasias epiteliales comunes, incluidas las de pulmón, colon y próstata. Shimakage y col. (2002) examinaron la presencia de VEB en el carcinoma de células escamosas oral utilizando RNA ISH para EBER. También aparentemente detectaron la expresión de EBNA2 y LMP1 en estas lesiones. González y col. (2002) detectaron el ADN del VEB mediante PCR en una quinta parte de los cánceres orales y la expresión de LMP1 en casi todos los casos positivos al VEB. Curiosamente, la presencia de VEB fue significativamente más frecuente en los cánceres de la lengua lateral (curiosamente también el sitio de la leucoplasia pilosa oral) y se asoció con una mayor atipia nuclear.

Claramente, se requieren más estudios para corroborar estos hallazgos. En nuestra opinión, la designación definitiva de un tumor como "asociado al VEB" debería requerir una demostración inequívoca del genoma del VEB o de los productos génicos del virus dentro de la población de células tumorales. Desafortunadamente, gran parte de la metodología utilizada para detectar el VEB en muchos de estos estudios (donde se presume que la expresión de EBER es indetectable) ha implicado el análisis de secciones tumorales completas o reactivos de anticuerpos que carecen de especificidad. Se requerirán estudios futuros que utilicen metodologías sólidas para establecer si el CHC, el cáncer de mama o cualquiera de las otras neoplasias epiteliales comunes descritas anteriormente están realmente asociadas con el VEB.


Opciones de acceso

Obtenga acceso completo a la revista durante 1 año

Todos los precios son precios NETOS.
El IVA se agregará más adelante en el proceso de pago.
El cálculo de impuestos se finalizará durante el pago.

Obtenga acceso completo o por tiempo limitado al artículo en ReadCube.

Todos los precios son precios NETOS.


Resultados

Identificación de la familia de genes HD-zip en trigo

Los datos del genoma del trigo utilizados en este estudio se descargaron del ensamblaje del genoma de referencia chino Spring IWGSC RefSeq v1.1 (https: //wheat-urgi.versailles.inra. Fr /). En primer lugar, convertimos el genoma del trigo en una base de datos BLAST local utilizando la tubería UNIX. Entonces, usamos 90 Arabidopsis y secuencias de proteínas HD-Zip de arroz para realizar una búsqueda BLAST (BLASTP) contra esta base de datos local de blast usando cut-off mi-valor & lt1e-10. Después de eliminar todas las secuencias redundantes con el programa CD-hit, el resto de las secuencias de proteínas se sometieron aún más a la identificación del dominio HD y el motivo LZ utilizando la herramienta de investigación de arquitectura modular simple (SMART http://smart.embl-heidelberg.de/smart /set_mode.cgi? NORMAL = 1). En un estudio reciente, un total de 46 HD-Zip Los genes se identificaron en el trigo mediante un estudio bioinformático de todo el genoma [35]. En este estudio, identificamos además 67 HD-Zip genes en el último genoma del trigo y extendió el miembro total a 113. Según la información de posición genómica, 113 HD-Zip los genes se localizaron en los 21 cromosomas del trigo, con un rango de 3 a 8 por cromosoma. El cromosoma 5A / B / D tiene la mayor cantidad de genes HD-Zip (24 en total, 8 por cromosoma), seguido del cromosoma 4A / B / D (18 en total, 6 por cromosoma) (Tabla 1 Archivo adicional 1: Figura S1). De acuerdo con su relación filogenética, las 113 proteínas HD-Zip se agruparon en 40 grupos homoeólogos, y los miembros de cada uno de los 39 grupos se asignaron a subgenomas A, B o D. Finalmente, designamos trigo HD-Zip genes como TaHDZX_ZA, TaHDZX_ZB, o TaHDZX_ZD, donde X denota el número del gen y Z el cromosoma del trigo donde se encuentra. La información detallada de los genes de la familia HD-Zip en el trigo, incluida la nomenclatura propuesta en el estudio anterior [35], se enumeró en la Tabla 1. Como se muestra en la Tabla 1, el identificado HD-Zip los genes en el trigo codifican proteínas que varían de 192 (TaHDZ12-6D) a 890 (TaHDZ35-1B) aminoácidos (aa) de longitud con un promedio de 501 aa. Además, los pesos moleculares calculados de estas proteínas HD-Zip oscilaron entre 20,88 (TaHDZ12-6D) y 96,02 (TaHDZ35-1B) kDa. El pI teórico de las proteínas HD-Zip deducidas osciló entre 4,59 (TaHDZ5-6A) y 9,79 (TaHDZ12-6D).

Análisis filogenético de la familia de genes HD-zip

Nuestro estudio tuvo como objetivo comprender las relaciones filogenéticas entre las proteínas vegetales HD-Zip. Comenzamos por la identificación de HD-Zip genes de otras siete especies de plantas con diferentes niveles de complejidad para los cuales se podía acceder a genomas completos, incluyendo Chlamydomonas reinhardtii, Physcomitrella patens, las angiospermas monocotiledóneas Brachypodium distachyon, Oryza sativa, y Zea mays, y las angiospermas dicotiledóneas Arabidopsis thaliana, Populus trichocarpa, y Vitis vinifera. A partir de este análisis, encontramos que el HD-Zip La familia de genes parece estar restringida a las plantas terrestres, todos los genomas excepto el de las algas contienen genes para las proteínas HD-Zip. Luego analizamos sus relaciones evolutivas utilizando proteínas HD-Zip de longitud completa de ocho especies de plantas terrestres para construir un árbol filogenético de unión vecino. En consecuencia, el árbol filogenético se dividió en cuatro subfamilias bien conservadas, designadas como HD-Zip I a IV (Fig. 1a). El árbol filogenético también reveló la distribución sesgada por especies de estas proteínas HD-Zip de plantas (Fig. 1b). Los miembros de HD-Zip I consistían en la subfamilia más grande de las especies de plantas, excepto por Brachypodium distachyon y trigo, donde HD-Zip II y IV fueron los más grandes respectivamente. En contraste, la subfamilia HD-Zip III está compuesta por la menor cantidad de miembros HD-Zip, excepto el musgo (Fig. 1c). Subfamilia incluí 31 TaHDZ genes, agrupados en 11 grupos (TaHDZ1-4A / B / D, TaHDZ2-5A / B / D, TaHDZ3-4A / B / D, TaHDZ4-5A / B / D, TaHDZ5-6A / D, TaHDZ6-5A / B / D, TaHDZ7-2A / B / D, TaHDZ8-6A / B / D, TaHDZ9-4A / B / D, TaHDZ10-2B / D, y TaHDZ11-2A / B / D) De manera similar, la subfamilia II abarca 31 TaHDZ, agrupados en 12 grupos (TaHDZ12-6A / B / D, TaHDZ13-6A / B / D, TaHDZ14-7A / B / D, TaHDZ15-1A / B / D, TaHDZ16-4B / D, TaHDZ17-3B / D, TaHDZ18-5A / B / D, TaHDZ19-3A / B / D, TaHDZ20-1A / B / D, TaHDZ21-2A / B / D, TaHDZ22-4A, y TaHDZ23-7A / D) Mientras que la subfamilia III es la más pequeña y contiene 14 TaHDZ, que se agruparon en 5 grupos (TaHDZ24-3A / B / D, TaHDZ25-1A / B / D, TaHDZ26-4B / D, TaHDZ27-5A / B / D, y TaHDZ28-5A / B / D) subfamilia IV contenía 36 TaHDZy agrupados en 12 grupos (TaHDZ29-3A / B / D, TaHDZ30-4A / B / D, TaHDZ31-5A / B / D, TaHDZ32-3A / B / D, TaHDZ33-6A / B / D, TaHDZ34-7A / B / D, TaHDZ35-1A / B / D, TaHDZ36-6A / B / D, TaHDZ37-2A / B / D, TaHDZ38-5A / B / D, TaHDZ39-7A / B / D, y TaHDZ40-2A / B / D) (Tabla 1).

Filogenia y distribución de proteínas HD-Zip de ocho especies vegetales. un árbol filogenético de proteínas HD-Zip de Arabidopsis, Populus, Vitis, trigo, arroz, maíz, Brachypodiumy musgo. PhyML construyó la filogenia utilizando un análisis de máxima verosimilitud. Los valores de soporte de Bootstrap como porcentaje se muestran en las ramas principales seleccionadas. La barra indica sustituciones por sitio b Representación porcentual de HD-Zips en las ocho especies de plantas dentro de cada subfamilia c Representación porcentual de distribuciones para HD-Zips dentro de cada especie de planta

Para aclarar las relaciones paralog y ortholog de los miembros de HD-Zip de trigo, dividimos cada subfamilia en subclases. De acuerdo con este árbol filogénico remodelado (Fig.2), cada subfamilia contiene las proteínas HD-Zip de Arabidopsis, arroz y trigo, lo que sugiere que estas subfamilias aparecieron antes de la división dicot-monocotiledónea. De acuerdo con la nomenclatura en estudios previos de Arabidopsis y arroz [36], la subfamilia HD-Zip I se dividió en siete subclases, es decir, α, β, γ, δ, ε, φ y ζ (Fig. 2). Clade ε y φ contiene solo secuencias de Arabidopsis. El clado ζ contiene secuencias de arroz y trigo, sin miembros en Arabidopsis, lo que sugiere la pérdida de genes en Arabidopsis durante el largo período de evolución de este grupo. La subfamilia HD-Zip II se dividió en diez subclases, de α a κ, según Hu et al. (2012) [37]. El clado β contiene solo secuencias de Arabidopsis. El clado α y γ contiene secuencias de arroz, trigo y Arabidopsis. Mientras que los otros clados solo contienen secuencias de arroz y trigo. La subfamilia HD-Zip III sólo se dividió en tres subclados, designados como clado α, β y γ, de acuerdo con los estudios anteriores [37]. Cada clado contiene secuencias de arroz, trigo y Arabidopsis. La subfamilia HD-Zip IV también se dividió en seis subclados, denominados clade α, β, γ, δ, ε y ζ como en un estudio anterior [37]. El clado δ excluyó genes del arroz y Arabidopsis, mientras que el clado ζ incluyó solo secuencias de arroz y trigo. Patrones de agrupamiento específicos de Eudicot y monocotiledóneas de Genes HD-Zip surgió cuando se examinó la topología del árbol. Este patrón puede reflejar la historia evolutiva de estos subgrupos: HD-Zip Los genes en eudicots probablemente se conservaron después de que se separaron de las monocotiledóneas y luego se expandieron.

El árbol filogenético de las proteínas HD-Zip del trigo, Arabidopsis, maíz y arroz. Los miembros de la Cremallera HD los genes del trigo están marcados en rojo. Los prefijos de dos letras para los identificadores de secuencia indican la especie de origen. Ejército de reserva, Triticum aestivum A, Arabidopsis thaliana Os, Oryza sativa Zm, Zea mays. El árbol se construyó utilizando el algoritmo de unión de vecinos con 1000 bootstrap basado en las secuencias de longitud completa de proteínas HD-Zip. Las proteínas HD-Zip se agrupan en cuatro grupos distintos

Análisis de estructura genética y composición de motivos

La divergencia estructural exón-intrón puede desempeñar un papel importante en la evolución de múltiples familias de genes [38]. Construimos un árbol filogenético utilizando solo las 113 secuencias de proteína HD-Zip de trigo de longitud completa para examinar más a fondo los patrones en el trigo. Encontramos que las proteínas HD-Zip de trigo también pertenecían a las cuatro subfamilias descritas anteriormente (Fig. 3a). Además, mapeamos la organización exón / intrón en las regiones de codificación de cada TaHDZ gene. Específicamente, 21 TaHDZ los genes tenían dos intrones, 28 tenían tres intrones, 15 tenían cuatro intrones, dos tenían cinco intrones, dos tenían siete intrones, 11 tenían ocho intrones, 12 tenían nueve intrones, tres tenían 10 intrones, cinco tenían 11 intrones, dos tenían 15 intrones, dos tenían 16 intrones y 10 tenían 18 intrones (Fig. 3b, c). En general, los genes ortólogos están muy conservados con respecto a la estructura de los genes, y esta conservación es suficiente para revelar sus relaciones evolutivas [38]. En trigo HD-Zip Los genes dentro de la misma subfamilia compartían estructuras genéticas similares (número de intrones y longitud del exón), especialmente los miembros de las subfamilias HD-Zip I y HD-Zip III, es decir, los genes HD-Zip I tenían principalmente dos o tres intrones en sus regiones genéticas. y los genes HD-Zip III tenían principalmente 18 intrones. Sin embargo, las composiciones de exón / intrón en los genes HD-Zip II y IV eran más variables, es decir, los miembros de HD-Zip II poseían de dos a cuatro intrones, y el número de intrones en los miembros de la familia HD-Zip IV variaba de 4 a 11 ( Fig. 3b, c).

Relaciones filogenéticas y estructuras genéticas del trigo. HD-Zip genes. a El árbol filogenético de 113 proteínas HD-Zip de longitud completa de trigo se construyó mediante MEGA 6.0 utilizando el método Neighbor-Joining (NJ) con 1000 valores de arranque. B Estructuras exón / intrón del trigo HD-Zip genes. Los exones y los intrones están representados por recuadros de color púrpura y líneas grises, respectivamente. C La distribución de los números de intrones entre cuatro subfamilias distintas de trigo HD-Zip

Se sabe que el genoma alohexaploide del trigo harinero se formó por fusión de T. urartu (subgenoma A), Aegilops speltoides (subgenoma B), y A. tauschii (subgenoma D) genomas anteriores a hace varios cientos de miles de años. La mayoría (60,1 a 61,3%) de los genes de los subgenomas A, B y D tienen ortólogos en todos los genomas diploides relacionados. Para comprender en profundidad la ganancia o pérdida de intrones para homeologous TaHDZ genes en el trigo, las estructuras intrón / exón de TaHDZ Se compararon los genes que se agruparon basándose en el árbol filogenético. Entre estos, catorce grupos mostraron cambios en su estructura intrón / exón, incluyendo TaHDZ1-4A / B / D, TaHDZ3-4A / B / D, TaHDZ5-6A / D, TaHDZ10-2B / D, TaHDZ12-6A / B / D, TaHDZ20-1A / B / D, TaHDZ24-3A / B / D, TaHDZ25-1A / B / D, TaHDZ30-4A / B / D, TaHDZ32-3A / B / D, TaHDZ35-1A / B / D, TaHDZ38-5A / B / D, TaHDZ39-7A / B / D, y TaHDZ40-2A / B / D (Figura 3b). Debido a que hay muchos ortólogos en los subgenomas A, B y D del trigo, la ganancia / pérdida de intrones de estos ortólogos aumenta significativamente la complejidad del transcriptoma y el proteoma en el trigo.

Para examinar más a fondo la estructura diversa de las proteínas HD-Zip de trigo, los motivos conservados se identificaron mediante la búsqueda en la base de datos SALAD junto con la anotación posterior con InterPro (archivo adicional 2: Figura S2). Se encontró que siete de estos motivos estaban asociados con los dominios definidos funcionalmente. Los motivos 1 y 2 se refirieron al dominio HD, que es el dominio conservado típico que se encuentra en el medio de todas las proteínas TaHDZ, y el motivo 5 se asoció con el dominio LZ adyacente. Los motivos 17 y 34 se componían específicamente del dominio MEKHLA en proteínas de la subfamilia III de trigo (14 miembros). Los motivos 3 y 4 se asociaron con la región START, que se ha identificado en las proteínas de las subfamilias III y IV (archivo adicional 2: Figura S2). Las proteínas TaHDZ comparten composiciones de motivos similares que se agrupan, y esto indica que los miembros de un grupo dado poseen funcionalidades similares.

Perfil de expresión específico de tejido de TaHDZ genes

Los miembros de la familia de genes pueden exhibir diferentes patrones de expresión en diferentes tejidos para adaptarse a varios procesos fisiológicos. Para comprender mejor los patrones de expresión temporal y espacial y las funciones putativas de HD-Zip genes en el crecimiento y desarrollo del trigo, los patrones de expresión específicos de tejido del 113 TaHDZ Los genes se investigaron utilizando datos de secuencia de ARN de 10 tejidos diferentes. Todos TaHDZ Se encontró que los genes se expresan en al menos uno de los tejidos examinados (Fig. 4 Archivo adicional 3: Tabla S1). Subfamilia I TaHDZ Se descubrió que los genes se expresan mucho más en las raíces de las plántulas, los tallos, las hojas, las hojas bandera, las espigas jóvenes y los granos de 5 días, por ejemplo, TaHDZ1-4A / B / D se expresan altamente en hojas y granos de 5 días, TaHDZ8-6A / B / D se expresan altamente en hojas y espigas jóvenes (15 días de edad), y TaHDZ11-2A / B / D están altamente expresados ​​en hojas y picos de 5 días de edad (Fig. 4 Archivo adicional 4: Figura S3). Subfamilia II TaHDZ los genes se expresan más en las raíces de las plántulas, los tallos, las hojas, las hojas bandera y las espigas jóvenes, por ejemplo, TaHDZ19-3A / B / D se expresan altamente en picos jóvenes, mientras que TaHDZ20-1A / B / D se expresan en gran medida en los tallos de las plántulas, las hojas y las espigas de 5 días de edad (Fig. 4 Archivo adicional 5: Figura S4). Subfamilia III TaHDZ Los genes mostraron niveles de expresión relativamente más altos en los tallos, hojas y espigas jóvenes de las plántulas. TaHDZ24-3A / B / D se expresan altamente en hojas de plántulas, y TaHDZ27-5A / B / D se expresan en gran medida en los tallos y las hojas de las plántulas (Figura 4 Archivo adicional 6: Figura S5). Subfamilia IV TaHDZ Los genes están altamente expresados ​​en tallos de plántulas, espigas jóvenes y granos. TaHDZ29-3A / B / D están altamente expresados ​​en granos de 10 días, TaHDZ32-3A / B / D están altamente expresados ​​en granos de 5 a 20 días de edad, y TaHDZ38-5A / B / D están altamente expresados ​​en tallos de plántulas y picos jóvenes (Fig. 4 Archivo adicional 7: Figura S6). Por lo tanto, los genes de las cuatro subfamilias de HD-Zip de trigo muestran diferencias obvias en los patrones y niveles de expresión, lo que indica que estos genes han sufrido diferenciación funcional y redundancia. Vale la pena mencionar que la mayoría de genes homólogos muestran patrones de expresión similares durante el desarrollo. Sin embargo, también debe tenerse en cuenta que muchos perfiles de expresión agrupados no reflejan similitudes genéticas, y esto incluye las copias de individuos HD-Zip tipos de genes de los subgenomas. Algunos de ellos incluso muestran patrones de expresión opuestos. Por ejemplo, TaHDZ7, que se encuentra en el cromosoma 2D, se expresa preferentemente en las hojas de la plántula y las hojas bandera, mientras que el homólogo TaHDZ7 gen de 2A sólo se expresa en las hojas bandera, y el TaHDZ7 homólogo de 2B se expresa preferentemente en hojas bandera y picos de 5 días de edad (Fig. 4 Archivo adicional 4: Figura S3). TaHDZ37 en 2A muestra una expresión relativamente más alta en granos de 10 a 15 días de edad, mientras que su homólogo TaHDZ37 de 2B se expresa preferentemente en hojas de plántulas y granos de 20 días, y el homólogo de 2D está altamente expresado en granos de 15 días (Figura 4 Archivo adicional 7: Figura S6). Las divergencias en los perfiles de expresión entre genes homólogos de los diferentes subgenomas revelan que algunos de ellos pueden haber perdido su función o adquirido una nueva función tras la poliploidización durante la evolución del trigo.

Perfiles de expresión de TaHDZ genes en diez órganos o tejidos diferentes. El mapa de calor se dibujó en Log10-valores de expresión transformados. Los colores rojo o verde representan el nivel de expresión más alto o más bajo de cada transcripción en cada muestra. R, raíz de la plántula de trigo en la etapa de cinco hojas S, tallo de la plántula de trigo en la etapa de cinco hojas L, hoja de la plántula de trigo en la etapa de cinco hojas FL, hoja bandera en la etapa de partida YS5, espiga joven en la etapa de arranque temprano YS15, espiga en la etapa de rumbo GR5, grano de 5 días post-antesis GR10, grano de 10 días post-antesis GR15, grano de 15 días post-antesis GR20, grano de 20 días post-antesis

Patrones de expresión de TaHDZ genes en respuesta al estrés por sequía

La productividad del trigo se ve gravemente afectada por el estrés por sequía y, por lo tanto, el estudio de los genes que responden a la sequía es importante para aumentar el rendimiento del trigo. Muchos estudios han demostrado que la HD-Zip Los genes juegan un papel crucial en la respuesta al estrés abiótico en las plantas. Para obtener más información sobre las funciones del trigo. HD-Zip genes en la tolerancia al estrés, primero identificamos el cis-elementos dentro de la región promotora de 2 kb utilizando el programa en línea PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/). Encontramos una serie de cis-Elementos que actúan relacionados con la respuesta al estrés en el promotor de TaHDZs. Incluyeron DRE (elemento sensible a la deshidratación), ABRE (elemento sensible a ABA), MBS (sitio de unión MYB involucrado en la inducibilidad a la sequía), MYC (sitio de reconocimiento MYC), MYB (sitio de reconocimiento MYB) y LTR (sitio sensible a bajas temperaturas). elemento) (Archivo adicional 8: Tabla S2). Para comprender mejor el papel potencial de TaABFs en la respuesta al estrés por sequía, volvimos a analizar los perfiles de expresión de todo el trigo HD-Zip genes que utilizan datos de RNA-seq de raíces y hojas que fueron sometidas a tratamiento de sequía. Descubrimos que el trigo HD-Zip los genes podrían clasificarse principalmente en dos grupos basándose en sus patrones de expresión (Fig. 5a, b Fig. 6a, b). En hojas, los niveles de expresión de 45 TaHDZ Los genes fueron regulados positivamente en uno o más puntos de tiempo durante el tratamiento de estrés por sequía, esto incluyó 20 genes de la subfamilia HD-Zip I (TaHDZ2-5A / B / D, TaHDZ4-5A / B / D, TaHDZ5-6A / D, TaHDZ6-5A / B / D, TaHDZ7-2A / B / D, TaHDZ8-6A / B / D, TaHDZ9-4B / D, y TaHDZ11-2D), 19 genes de la subfamilia HD-Zip II (TaHDZ18-5A / B / D, TaHDZ20-1A / B, TaHDZ16-4A / B / D, TaHDZ12-6A / D, TaHDZ13-6A / B / D, TaHDZ14-7A / B, TaHDZ15-1A / B / D, y TaHDZ17-3D), un gen de la subfamilia HD-Zip III (TaHDZ24-3A) y cinco genes de la subfamilia HD-Zip IV (TaHDZ29-3A, TaHDZ30-4B, TaHDZ31-5D, TaHDZ37-2A / B) (Figuras 5a, cyd). En contraste, 50 TaHDZ los genes mostraron expresión regulada negativamente bajo estrés por sequía, incluidos siete genes de la subfamilia I, seis genes de la subfamilia II, 12 genes de la subfamilia III y 25 genes de la subfamilia IV (Fig. 5a, c, d). En raíces, 34 TaHDZ Se encontró que los genes estaban regulados positivamente en respuesta al estrés por sequía, incluidos 16 genes de la subfamilia I (TaHDZ4-5A / B / D, TaHDZ6-5A / B, TaHDZ7-2A / B / D, TaHDZ8-6A / B / D, TaHDZ9-4B / D, y TaHDZ11-2A / B / D), 16 genes de la subfamilia II (TaHDZ15-1A / B / D, TaHDZ16-4A / B / D, TaHDZ17-3B, TaHDZ19-3A / B / D, TaHDZ20-1A / B / D, TaHDZ21-2A / B, y TaHDZ22-4A) y dos genes de la subfamilia IV (TaHDZ37-2B y TaHDZ40-2B) (Figuras 6a, c, d). En contraste, 51 TaHDZ los genes se regularon negativamente bajo estrés por sequía en las raíces, incluidos 12 genes de la subfamilia I, 8 genes de la subfamilia II, 13 genes de la subfamilia III y 18 genes de la subfamilia IV (Fig. 6a, c, d). Estos resultados indican que la mayoría TaHDZ Los genes de las subfamilias I y II pueden desempeñar un papel importante en la respuesta al estrés por sequía.

Perfiles de expresión de TaHDZ genes en hojas de plántulas bajo tratamiento de estrés por sequía. a agrupamiento jerárquico del nivel de expresión relativo de TaHDZ genes sometidos a tratamiento de estrés por sequía. El mapa de calor se dibujó en Log10-valores de expresión transformados. Los colores rojo o verde representan la abundancia relativa mayor o menor de cada transcripción en cada muestra. B Patrones de expresión de TaHDZ genes sometidos a tratamiento de estrés por sequía. C El número de regulados al alza y regulados a la baja TaHDZ genes en cuatro subfamilias HD-Zip. D Los ratios de regulado al alza y regulado a la baja TaHDZ genes en cuatro subfamilias HD-Zip

Perfiles de expresión de TaHDZ genes en raíces de plántulas bajo tratamiento de estrés por sequía. a Agrupación jerárquica del nivel de expresión relativo de TaHDZ genes sometidos a tratamiento de estrés por sequía. El mapa de calor se dibujó en Log10-valores de expresión transformados. Los colores rojo o verde representan la abundancia relativa mayor o menor de cada transcripción en cada muestra. B Patrones de expresión de TaHDZ genes sometidos a tratamiento de estrés por sequía. C El número de regulados al alza y regulados a la baja TaHDZ genes en cuatro subfamilias HD-Zip. D Las proporciones de regulado al alza y regulado a la baja TaHDZ genes en cuatro subfamilias HD-Zip

TaHDZ5-6A confiere tolerancia a la sequía en Arabidopsis

El análisis filogenético y los perfiles de expresión génica sugieren que TaHDZ5-6A / D puede participar en la regulación de la respuesta al estrés por sequía en el trigo. El análisis de la secuencia de proteínas reveló que TaHDZ5-6A y TaHDZ5-6D comparten una similitud de secuencia del 95% (archivo adicional 9: Figura S7). Para confirmar aún más el papel potencial de TaHDZ5 En la respuesta al estrés por sequía, realizamos PCR cuantitativa en tiempo real (qRT-PCR) utilizando ARN aislado de diferentes tejidos y condiciones de sequía. Los cebadores de PCR se diseñaron para amplificar los alelos homólogos de TaHDZ5. Los resultados mostraron que TaHDZ5 se expresa en niveles más altos en las hojas de las plántulas, hojas bandera y espigas jóvenes, con la mayor expresión detectada en las hojas de las plántulas, y TaHDZ5 fue regulado al alza durante todo el período de prueba por el estrés por sequía (Archivo adicional 10: Figura S8). Para investigar más a fondo el papel de TaHDZ5 en la respuesta al estrés por sequía, generamos 35S :: TaHDZ5-6A transgénico Arabidopsis líneas. Tres líneas transgénicas independientes (OE1, OE2, y OE3) fueron elegidos para el análisis en función de su TaHDZ5-6A niveles de expresión (Fig. 7a). WT y 35S :: TaHDZ5-6A Las plantas transgénicas se cultivaron durante 3 semanas en el suelo antes de que se retuviera el agua durante 14 d. No hubo diferencias fenotípicas obvias entre 35S :: TaHDZ5-6A plantas transgénicas y WT en condiciones normales (Fig. 7c). Después del tratamiento de sequía y seis días de rehidratación, entre el 72% y el 88% de los 35S :: TaHDZ5-6A plantas habían sobrevivido, mientras que sólo

El 8% de las plantas WT estaban vivas (Fig. 7b, c). Por lo tanto, el ectópico de TaHDZ5-6A tolerancia a la sequía muy mejorada en transgénicos Arabidopsis.

Fenotipo del 35S: TaHDZ5-6A transgénico Arabidopsis. a Análisis de RT-PCR de TaHDZ5-6A niveles de transcripción en las tres líneas transgénicas. B Análisis estadístico de las tasas de supervivencia después del tratamiento de estrés por sequía.Las tasas de supervivencia promedio y los errores estándar se calcularon sobre la base de los datos obtenidos de tres experimentos independientes. Las diferencias significativas fueron determinadas por un t-prueba. *PAG & lt 0.05, **PAG & lt 0.01. C Tolerancia a la sequía de 35S: TaHDZ5-6A transgénico Arabidopsis. Se tomaron fotografías antes y después del tratamiento de sequía, seguidas de un período de riego de seis días. D Apertura estomática de WT y 35S :: TaHDZ5-6A plantas transgénicas en condiciones normales y de sequía. mi Análisis estadístico de la apertura estomática de WT y 35S :: TaHDZ5-6A plantas transgénicas. Los valores son proporciones medias de ancho a largo. Las barras de error representan errores estándar de tres experimentos independientes (norte = 60). Barras, 10 μm. F Pérdida de agua de rosetas desprendidas de WT y 35S :: TaHDZ5-6A plantas transgénicas. La pérdida de agua se expresó como porcentaje del peso fresco inicial. Los valores son medias de ocho plantas para cada uno de los tres experimentos independientes. Las diferencias significativas fueron determinadas por un t-prueba. *PAG & lt 0.05, **PAG & lt 0.01. gramo Contenido de prolina libre de WT y 35S :: TaHDZ5-6A Plantas transgénicas bajo tratamiento normal y de estrés por sequía.

Las aberturas estomáticas de las hojas de 35S :: TaHDZ5-6A y se midieron las plantas WT cultivadas en el suelo. Los índices de apertura estomática del OE1, OE2, y OE3 las plantas fueron 0,41, 0,42 y 0,41, respectivamente, mientras que la de las plantas WT fue 0,40, cuando se cultivaron en condiciones normales (Fig. 7d, e). Después de ser sometido a 10 d de estrés por sequía, los índices de apertura estomática del OE1, OE2, y OE3 las plantas disminuyeron a 0,22, 0,18 y 0,22, respectivamente, reducidas significativamente en comparación con las de WT (Fig. 7d, e). De acuerdo con estos resultados, la pérdida de agua en las hojas desprendidas de 35S :: TaHDZ5-6A las plantas transgénicas fueron mucho más lentas que las de las plantas WT deshidratadas (Fig. 7f). Estos resultados indican que el 35S :: TaHDZ5-6A Las plantas transgénicas eliminaron el agua del suelo más lentamente que las plantas WT, reduciendo la tasa de marchitamiento. Para explorar si TaHDZ5-6A expresión ectópica influye en la acumulación de prolina, comparamos el contenido de prolina libre en 35S :: TaHDZ5-6A plantas transgénicas y WT. De acuerdo con el fenotipo de tolerancia a la sequía, los contenidos de prolina fueron mucho más altos en las plantas transgénicas que en las plantas WT en condiciones de sequía (Fig. 7g). Estos hallazgos indican colectivamente que TaHDZ5-6A puede mejorar la tolerancia a la sequía en transgénicos Arabidopsis.

Cambios en la expresión génica global en 35S :: TaHDZ5-6A transgénico Arabidopsis

La secuenciación de ARN nos permitió comprender cómo la tolerancia a la sequía fue conferida por el ectópico de TaHDZ5-6A. El transcriptoma del 35S :: TaHDZ5-6A Las plantas transgénicas se compararon con las de las plantas WT en condiciones normales sin estrés. En plantas transgénicas, un total de 495 y 111 genes fueron regulados positivamente y regulados negativamente por al menos 2 veces (PAG & lt 0.001, FDR & lt 0.05) en comparación con el WT (Fig. 8a, b Archivo adicional 11: Tabla S3). Los genes regulados al alza incluían genes relacionados con la privación de agua, ácido abscísico, hormonas y estímulos abióticos, y las vías reguladas a la baja incluían aquellas que respondían a estímulos de auxina, estrés oxidativo y respuestas de defensa (Fig. 8c). Luego elegimos 10 genes regulados positivamente en plantas transgénicas y que se sabe que están involucrados en respuesta a la sequía: DREB2A [39], RD29A [40], RD29B [40], RD26 [41], RD17 [42], PP2CA [43], RAB18 [42], ANAC019 [44], NCED3 [45], y RD20 [46]. Usamos qRT-PCR para medir sus niveles de expresión relativa en condiciones normales y de sequía en plantas transgénicas y WT (Fig. 8d). Los resultados de qRT-PCR estaban alineados con los de RNA-seq, lo que indica que TaHDZ5-6A puede regular positivamente la transcripción de estos 10 genes y, por lo tanto, desempeñar un papel en la respuesta, incluido el cierre rápido de estomas y la reducción de la pérdida de agua, de transgénicos Arabidopsis plantas en condiciones de sequía.

Análisis transcriptómicos del 35S :: TaHDZ5-6A transgénico Arabidopsis en condiciones normales. a diagramas de Venn de genes regulados hacia arriba o hacia abajo en plantas transgénicas en relación con las plantas WT utilizando un límite significativo de PAG & lt 0,001, y un cambio de pliegue (FC) & gt 2. B Agrupación jerárquica de genes regulados hacia arriba o hacia abajo en 35S :: TaHDZ5-6A transgénico Arabidopsis líneas relativas a plantas WT. La escala indicada es el registro2 valor del nivel normalizado de expresión génica. C Ontología genética de vías biológicas (GOBP) enriquecida en TaHDZ5-6A plantas transgénicas basadas en genes regulados hacia arriba o hacia abajo. D Análisis de qRT-PCR de genes inducidos por sequía en las plantas transgénicas y WT en condiciones normales y de sequía. Las barras de error indican desviaciones estándar derivadas de tres experimentos biológicos independientes. Las diferencias significativas fueron determinadas por un t-prueba. *PAG & lt 0.05, **PAG & lt 0.01


Materiales y métodos

Procesamiento previo de datos de entrada

Primero generamos una matriz binaria de predicciones de interacciones reguladoras del gen TF. Para las predicciones basadas en datos de chips ChIP específicos de la condición, se codificó un "1" si el enlace PAG-valor de la TF a la región promotora del gen fue & lt0.005, de lo contrario, se codificó un "0". Para TF sin datos de chip ChIP específicos de la condición, seguimos una versión del código regulatorio de Harbison et al (2004). Para estos TF, un par TF-gen tenía un "1" codificado en la matriz si el TF unía al promotor del gen con un PAG-valor & lt0.005 en al menos un experimento de chip de chip y había un motivo en su promotor que se conservó evolutivamente en al menos otras dos especies de levadura. Si no se disponía de datos del chip ChIP para un gen, se codificaba un "0" para todas las entradas. Todos los datos de series de tiempo se transformaron para comenzar en "0", de modo que el valor en cada punto de tiempo representa el cambio de la relación logarítmica de un control sin estrés. Los genes se filtraron si faltaba más de un valor o si el gen no cambiaba lo suficiente en algún momento (consulte la sección Resultados en Información complementaria).

Algoritmo de minero de eventos regulatorios dinámicos

Cada estado del modelo probabilístico está asociado con una distribución gaussiana. Se utilizó una estructura de árbol entre los estados y sus transiciones. En el momento 0, hay un estado, que es la raíz del árbol. Todos los estados, excepto los asociados con el último punto temporal, tienen al menos un hijo, y para los resultados de este documento no permitimos más de dos hijos. Cualquier estado que tenga más de un hijo tiene un clasificador de regresión logística con L1 pena de pérdida (Krishnapuram et al, 2005) asociado con él. Este clasificador mapea el conjunto de interacciones TF predichas para un gen a una distribución de probabilidad de transiciones a cada uno de los estados secundarios. Para aprender un mapa regulatorio dinámico, el algoritmo DREM primero realiza una búsqueda sobre estructuras de árbol. Se utiliza un subconjunto de genes seleccionados al azar para entrenar los parámetros de distribución gaussianos y los clasificadores en la estructura de árbol en consideración. Los genes restantes se utilizan para puntuar las diversas estructuras arbóreas consideradas. El entrenamiento se lleva a cabo utilizando una versión del algoritmo de Baum-Welch (Durbin et al, 1998). Una vez que se encuentra la mejor estructura de puntuación utilizando el conjunto de genes de prueba, se podan las divisiones con soporte débil para evitar sobreajustar el conjunto de genes de prueba. Una vez seleccionada la estructura del modelo final, todos los genes se utilizan para entrenar los parámetros del modelo final. Consulte la sección Métodos en Información complementaria para obtener detalles completos.

Software DREM: El software DREM está disponible para su descarga en http://www.sb.cs.cmu.edu/drem.

Inferir asignaciones de genes y puntuaciones de TF

Los genes se asignan a su ruta más probable a través del modelo utilizando el algoritmo de Viterbi (Durbin et al, 1998). La asignación de genes a las rutas a través de los modelos se utiliza para determinar si ciertas rutas están enriquecidas en exceso para genes regulados por ciertos TF. Las puntuaciones de enriquecimiento excesivo se utilizan para la asociación de TF con trayectorias. Estos puntajes se obtienen utilizando la distribución hipergeométrica, con un puntaje más bajo significa una asociación más fuerte. El conjunto básico de genes para la distribución hipergeométrica puede ser solo los genes que entran en la división anterior, lo que da una puntuación de asociación de división de TF, o todos los genes en el microarray dan una puntuación de asociación general de TF para una ruta.

IR PAG-valors

IR PAG-Los valores se calcularon en el software DREM basándose en la distribución hipergeométrica. Todos PAG-Los valores informados no están corregidos, pero siguen siendo significativos al nivel de 0,01 cuando se corrigen para pruebas de hipótesis múltiples mediante un procedimiento de aleatorización (Ernst y Bar-Joseph, 2006).

Saccharomyces cerevisiae lista de cepas

Para los experimentos de inmunoprecipitación, utilizamos la cepa de levadura W303 etiquetada con Myc obtenida como regalo de Rick Young. El genotipo de la cepa Ino4 es MATa: ade2-1: trp1-1: can1-100: leu2-3,112: his3-11,15: ura3: GAL +: psi +: INO4 :: 9myc: TRP1 y de la cepa Gcn4 es MATa : ade2-1: trp1-1: can1-100: leu2-3,112: his3-11,15: ura3: GAL +: psi +: GCN4 :: 9myc: TRP1.

Condición de crecimiento

Para los experimentos de inanición de AA, las células se cultivaron en medio mínimo completo (SCD) hasta la fase de registro temprano. Las células se recogieron por centrifugación y se resuspendieron en un volumen igual de medio mínimo que carecía de AA y adenina (YNB-AA, glucosa al 2%, uracilo 20 mg / l) y se dejaron crecer. Las muestras para el análisis de la ubicación se tomaron antes de la resuspensión en condiciones de inanición de AA y 4 h después.

Para los experimentos de MMS, las células se cultivaron en medio YPD hasta la fase de registro temprano a 30 ° C hasta que el cultivo alcanzó una DO.600 de 0,8-1,0. Se añadió MMS (Sigma) hasta una concentración final del 0,03% y el cultivo se dejó crecer durante una hora más. Se tomaron muestras para el análisis de ubicación de todo el genoma antes de agregar MMS y 15 y 60 minutos después de agregar MMS.

Inmunoprecipitación de cromatina: PCR

Las proteínas unidas se reticularon con formaldehído al ADN en vivo, seguido de lisis celular y sonicación para cortar el ADN. El material reticulado se inmunoprecipitó con un anticuerpo anti-myc, seguido de la inversión de los enlaces cruzados para separar el ADN de la proteína (Aparicio 1999 Orlando, 2000). El enriquecimiento para el sitio de unión de Ino4 se midió mediante PCR semicuantitativa utilizando cebadores diseñados para la detección de regiones cadena arriba de los genes YDR497C, YNL169C, YGR196C e YHR123W. Las secuencias de cebadores son las siguientes: YDR497C: TAGCGCACCAAACTGAAAGA, YNL169C AAGCGCATATACTTAGTTCTCTCCA: CGACCAAGAAGGATTTGAGC, YGR196C CCAGCACCTTTTTGGTGTTT: CGCTTTCCAGAAAAAGGGTA, CGTCGTTTGTTTGTTTGGTG YHR123W: TGGCAAAATACAGAACACAGG, TATGCTCAGTCCAGCCCTTT. Como control negativo, se utilizaron cebadores para la región aguas arriba de Cts1 (AGTGGTTGGTTGGTGGGAATA TCTTTGACCAATGCCTATGAA). La cuantificación del enriquecimiento se realizó calculando la relación de la señal IP y la señal de entrada para el gen diana dividida por la relación IP y la relación de entrada del gen de control negativo (Cts1), utilizando el software TINA. TINA es un software para la cuantificación de la intensidad de la banda. Después de la PCR, los fragmentos se separaron en gel de agarosa (1%) y se monitorizaron mediante una cámara CCD. Las intensidades de las bandas se cuantificaron utilizando el software de cuantificación TINA 2.09d (Raytest, http://www.raytest.de).

Chip en chip

El análisis de ubicación de todo el genoma se realizó como se describió anteriormente (Ren et al, 2000). Brevemente, después de la purificación del ADN en el procedimiento de ChIP, el ADN inmunoprecipitado y el ADN de una muestra no enriquecida se amplificaron y se marcaron con fluorescencia diferencial mediante PCR mediada por ligación. Estas muestras se hibridaron con una micromatriz que consta de productos de PCR manchados que representan las regiones intergénicas del S. cerevisiae genoma. Los datos se han depositado en ArrayExpress con los números de acceso E-MEXP-905 (experimentos Gcn4) y E-MEXP-906 (experimentos Ino4).

Cálculo del índice de brotación

Las células que crecieron continuamente a 30 ° C se recogieron mediante centrifugación, se resuspendieron en un volumen igual de medio a 37 ° C y se devolvieron a 37 ° C para su crecimiento. Las muestras se recolectaron en puntos de tiempo como se describe en la Figura 4C. Para cada punto de tiempo, las células se sonicaron suavemente para separar los grupos, se contaron y dividieron en tres grupos: 'No Bud' - una sola célula 'Small Bud' - una celda con un pequeño brote adjunto y un 'Big Bud' - un célula con una yema que es más de la mitad del tamaño de la célula a la que está adherida.


Ver el vídeo: Mi hija quiere entender el sistema financiero. Hernan Casciari. TEDxMontevideo (Agosto 2022).